Multi-morbidities of allergic rhinitis in adults: European Academy of Allergy and Clinical Immunology Task Force Report.

Multi-morbidities of allergic rhinitis in adults: European Academy of Allergy and Clinical Immunology Task Force Report.

This report has been ready by the European Academy of Allergy and Clinical Immunology Task Force on Allergic Rhinitis (AR) comorbidities. The goal of this multidisciplinary European consensus doc is to spotlight the function of multimorbidities in the definition, classification, mechanisms, suggestions for prognosis and remedy of AR, and to outline the wants in this uncared for space by a literature overview.

AR is a systemic allergic illness and is mostly related to quite a few multi-morbid problems, together with bronchial asthma, eczema, meals allergic reactions, eosinophilic oesophagitis (EoE), conjunctivitis, power center ear effusions, rhinosinusitis, adenoid hypertrophy, olfaction problems, obstructive sleep apnea, disordered sleep and consequent behavioural and instructional results.

This report supplies up-to-date usable data to: (1) enhance the data and expertise of allergists, in order to in the end enhance the general high quality of affected person care; (2) to extend curiosity in this space; and (3) to current a singular contribution to the sphere of higher inflammatory illness.

 Multi-morbidities of allergic rhinitis in adults: European Academy of Allergy and Clinical Immunology Task Force Report.
Multi-morbidities of allergic rhinitis in adults: European Academy of Allergy and Clinical Immunology Task Force Report.

A piece group report on ultrafine particles (American Academy of Allergy, Asthma & Immunology): Why ambient ultrafine and engineered nanoparticles ought to obtain particular consideration for doable hostile well being outcomes in human topics.

Ultrafine particles (UFPs) are airborne particulates of lower than 100 nm in aerodynamic diameter. Examples of UFPs are diesel exhaust particles, merchandise of cooking, heating, and wooden burning in indoor environments, and, extra not too long ago, merchandise generated by the use of nanotechnology. Studies have proven that ambient UFPs have detrimental results on each the cardiovascular and respiratory techniques, together with the next incidence of atherosclerosis and exacerbation fee of bronchial asthma.

Human Mesenchymal Stem Cells

SC00A1 500000
EUR 905.00

anti-CD34 Hematopoietic precursor cells

513-A-01mg 0,1 mg
EUR 267.50
  • Category: Antibody, Signal Transduction Antibodies, mAb
Description: anti-CD34 Hematopoietic precursor cells

anti-CD34 Hematopoietic precursor cells

513-A-1000ug 1000 ug
EUR 1282.50
  • Category: Antibody, Signal Transduction Antibodies, mAb
Description: anti-CD34 Hematopoietic precursor cells

Mouse Bone Marrow PrimaCell: Hematopoietic Cells

2-82094 1 Kit Ask for price

Rat Bone Marrow PrimaCell: Hematopoietic Cells

2-82590 1 Kit Ask for price

Human Bone Marrow PrimaCell: Hematopoietic Cells

2-96116 1 Kit Ask for price

Mesenchymal Stem Cells - Adipose Derived

SC00AD1 500,000 Cells
EUR 905.00

Mesenchymal Stem Cells - Placental Derived

SC00P1 500,000 cells
EUR 905.00

Neural Stem Cells (iPSC from Blood Cells; Male)

ASE-9234 1 vial (1 x 10^6)
EUR 414.50
Description: 12 month

Neural Stem Cells (iPSC from Blood Cells; Female)

ASE-9234F 1 vial (1 x 10^6)
EUR 414.50
Description: 12 month

Human Neural Stem Cells Differentiation Kit

abx298022-100ml 100 ml
EUR 314.00
  • Shipped within 5-10 working days.

Human Neural Stem Cells Expansion Kit

abx298023-1Kit 1 Kit
EUR 272.00
  • Shipped within 5-10 working days.

Mesenchymal Stem Cells - Bone Marrow Derived

SC00BM1 500,000 cells
EUR 905.00

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNCR2185-250 250uL
EUR 394.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), RPE conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNCR2598-250 250uL
EUR 394.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), RPE conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNUB2185-100 100uL
EUR 264.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), Concentration: 0.2mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNUB2185-50 50uL
EUR 405.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), 1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNUB2185-500 500uL
EUR 513.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), Concentration: 0.2mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNUB2598-100 100uL
EUR 264.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), Concentration: 0.2mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNUB2598-50 50uL
EUR 405.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), 1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNUB2598-500 500uL
EUR 513.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), Concentration: 0.2mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC552185-100 100uL
EUR 233.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF555 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC552185-500 500uL
EUR 545.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF555 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC552598-100 100uL
EUR 233.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF555 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC552598-500 500uL
EUR 545.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF555 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC612185-100 100uL
EUR 233.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF660R conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC612185-500 500uL
EUR 545.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF660R conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC432185-100 100uL
EUR 233.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF543 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC432185-500 500uL
EUR 545.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF543 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC432598-100 100uL
EUR 233.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF543 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC432598-500 500uL
EUR 545.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF543 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC472185-100 100uL
EUR 233.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF647 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC472185-500 500uL
EUR 545.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF647 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC472598-100 100uL
EUR 233.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF647 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC472598-500 500uL
EUR 545.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF647 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC042185-100 100uL
EUR 233.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF405S conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC042185-500 500uL
EUR 545.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF405S conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC042598-100 100uL
EUR 233.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF405S conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC042598-500 500uL
EUR 545.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF405S conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC052185-100 100uL
EUR 233.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF405M conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC052185-500 500uL
EUR 545.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF405M conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC052598-100 100uL
EUR 233.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF405M conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC052598-500 500uL
EUR 545.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF405M conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC402185-100 100uL
EUR 233.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF640R conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC402185-500 500uL
EUR 545.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF640R conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC402598-100 100uL
EUR 233.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF640R conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC402598-500 500uL
EUR 545.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF640R conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC702185-100 100uL
EUR 233.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF770 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC702185-500 500uL
EUR 545.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF770 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC702598-100 100uL
EUR 233.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF770 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC702598-500 500uL
EUR 545.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF770 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC802185-100 100uL
EUR 233.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF680 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC802185-500 500uL
EUR 545.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF680 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC802598-100 100uL
EUR 233.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF680 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC802598-500 500uL
EUR 545.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF680 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNCH2185-100 100uL
EUR 233.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNCH2185-500 500uL
EUR 545.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNCH2598-100 100uL
EUR 233.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNCH2598-500 500uL
EUR 545.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNCP2185-250 250uL
EUR 394.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), PerCP conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNCP2598-250 250uL
EUR 394.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), PerCP conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC942185-100 100uL
EUR 233.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF594 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC942185-500 500uL
EUR 545.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF594 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC942598-100 100uL
EUR 233.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF594 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC942598-500 500uL
EUR 545.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF594 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNCA2185-250 250uL
EUR 394.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), APC conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNCA2598-250 250uL
EUR 394.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), APC conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNCB2185-100 100uL
EUR 233.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), Biotin conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNCB2185-500 500uL
EUR 545.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), Biotin conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNCB2598-100 100uL
EUR 233.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), Biotin conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNCB2598-500 500uL
EUR 545.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), Biotin conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC882185-100 100uL
EUR 233.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF488A conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC882185-500 500uL
EUR 545.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF488A conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC882598-100 100uL
EUR 233.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF488A conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC882598-500 500uL
EUR 545.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF488A conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC682185-100 100uL
EUR 233.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF568 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC682185-500 500uL
EUR 545.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF568 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC682598-100 100uL
EUR 233.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF568 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC682598-500 500uL
EUR 545.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF568 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNCAP2185-100 100uL
EUR 233.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNCAP2185-500 500uL
EUR 545.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNCAP2598-100 100uL
EUR 233.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNCAP2598-500 500uL
EUR 545.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC812185-100 100uL
EUR 233.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF680R conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC812185-500 500uL
EUR 545.00
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF680R conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC812598-100 100uL
EUR 233.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF680R conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC812598-500 500uL
EUR 545.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF680R conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC612598-100 100uL
EUR 233.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF660R conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC612598-500 500uL
EUR 545.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF660R conjugate, Concentration: 0.1mg/mL

Anti-Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) Monoclonal Antibody

M03359 100ug/vial
EUR 397.00
Description: Mouse Monoclonal Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) Antibody. Validated in Flow Cytometry, IP and tested in Human, Rabbit, Rat.

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker); Clone 3D3 (Concentrate)

RA0264-C.1 0.1 ml
EUR 125.00

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker); Clone 3D3 (Concentrate)

RA0264-C.5 0.5 ml
EUR 300.00

Human Bone Marrow CD34+ Stem Cells, Cryopreserved


Human Bone Marrow CD34+ Stem Cells, Cryopreserved


Human Bone Marrow CD34+ Stem Cells, Cryopreserved


Human Bone Marrow CD34+ Stem Cells, Fresh


Human Bone Marrow CD34+ Stem Cells, Fresh


Human Mesenchymal Stem Cells - Bone Marrow Derived

MSC001 500,000+ Cells
EUR 1288.00

Human Mesenchymal Stem Cells-Green Fluorescent-Labeled

SC00A2 500000
EUR 962.00

Human Mesenchymal Stem Cells-Red Fluorescent-Labeled

SC00A3 500000
EUR 962.00

Human Mesenchymal Stem Cells Expressing Oct3/4

SC00A6 500000
EUR 1184.00

Immortalized Human Pancreatic Mesenchymal Stem Cells - SV40

T0167 1x106 cells / 1.0 ml Ask for price

Immortalized Human Pancreatic Mesenchymal Stem Cells - hTERT

T0168 1x106 cells / 1.0 ml Ask for price

Immortalized Human Pancreatic Mesenchymal Stem Cells - Myc

T0169 1x106 cells / 1.0 ml Ask for price

Immortalized Human Pancreatic Mesenchymal Stem Cells - Ras

T0170 1x106 cells / 1.0 ml Ask for price

Immortalized Mouse Intestinal Crypt Stem Cells (iMICs)

T0564 1x106 cells / 1.0 ml Ask for price

Immortalized Human Amniotic Fluid Stem Cells - SV40

T0903 1x106 cells / 1.0 ml Ask for price

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNUM1806-50 50uL
EUR 395.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R), 1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNUB1806-100 100uL
EUR 209.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R), Concentration: 0.2mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNUB1806-500 500uL
EUR 458.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R), Concentration: 0.2mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNC551806-100 100uL
EUR 199.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),CF555 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNC551806-500 500uL
EUR 544.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),CF555 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNC611806-100 100uL
EUR 199.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),CF660R conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNC611806-500 500uL
EUR 544.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),CF660R conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNC471806-100 100uL
EUR 199.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),CF647 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNC471806-500 500uL
EUR 544.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),CF647 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNC041806-100 100uL
EUR 199.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),CF405S conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNC041806-500 500uL
EUR 544.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),CF405S conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNC051806-100 100uL
EUR 199.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),CF405M conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNC051806-500 500uL
EUR 544.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),CF405M conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNC401806-100 100uL
EUR 199.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),CF640R conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNC401806-500 500uL
EUR 544.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),CF640R conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNC431806-100 100uL
EUR 199.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),CF543 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNC431806-500 500uL
EUR 544.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),CF543 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNC701806-100 100uL
EUR 199.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),CF770 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNC701806-500 500uL
EUR 544.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),CF770 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNC801806-100 100uL
EUR 199.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),CF680 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNC801806-500 500uL
EUR 544.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),CF680 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNCH1806-100 100uL
EUR 199.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNCH1806-500 500uL
EUR 544.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNCP1806-250 250uL
EUR 383.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),PerCP conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNCR1806-250 250uL
EUR 383.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),RPE conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNC941806-100 100uL
EUR 199.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),CF594 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNC941806-500 500uL
EUR 544.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),CF594 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNCA1806-250 250uL
EUR 383.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),APC conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNCB1806-100 100uL
EUR 199.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),Biotin conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNCB1806-500 500uL
EUR 544.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),Biotin conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNC881806-100 100uL
EUR 199.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),CF488A conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNC881806-500 500uL
EUR 544.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),CF488A conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNC681806-100 100uL
EUR 199.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),CF568 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNC681806-500 500uL
EUR 544.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),CF568 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNCAP1806-100 100uL
EUR 199.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNCAP1806-500 500uL
EUR 544.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNC811806-100 100uL
EUR 199.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),CF680R conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R) Antibody

BNC811806-500 500uL
EUR 544.00
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/1806R),CF680R conjugate, Concentration: 0.1mg/mL

Monoclonal Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) Antibody, Clone: 3D3

AMM01202G 7 ml
EUR 484.00
Description: A Monoclonal antibody against Human Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker). The antibodies are raised in Mouse and are from clone 3D3. This antibody is applicable in WB, IHC and IF, FC, IP

Monoclonal Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) Antibody, Clone: 2A4

AMM01205G 7 ml
EUR 484.00
Description: A Monoclonal antibody against Human Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker). The antibodies are raised in Mouse and are from clone 2A4. This antibody is applicable in IHC, IF, FC

Monoclonal CD34 (Hematopoietic Stem Cell & Endothelial Marker) Antibody, Clone: SPM123

AMM01547G 7 ml
EUR 484.00
Description: A Monoclonal antibody against Human CD34 (Hematopoietic Stem Cell & Endothelial Marker). The antibodies are raised in Mouse and are from clone SPM123. This antibody is applicable in IHC, IF, FC

Monoclonal CD34 (Hematopoietic Stem Cell & Endothelial Marker) Antibody, Clone: SPM610

AMM01557G 7 ml
EUR 484.00
Description: A Monoclonal antibody against Human CD34 (Hematopoietic Stem Cell & Endothelial Marker). The antibodies are raised in Mouse and are from clone SPM610. This antibody is applicable in WB, IHC and IF, FC

CD34 (Hematopoietic Stem Cell & Endothelial Marker); Clone QBEnd/10 (Concentrate)

RA0052-C.1 0.1 ml
EUR 125.00

CD34 (Hematopoietic Stem Cell & Endothelial Marker); Clone QBEnd/10 (Concentrate)

RA0052-C.5 0.5 ml
EUR 300.00

CD34 (Hematopoietic Stem Cell & Endothelial Marker); Clone HPCA1/763 (Concentrate)

RA0053-C.1 0.1 ml
EUR 125.00

CD34 (Hematopoietic Stem Cell & Endothelial Marker); Clone HPCA1/763 (Concentrate)

RA0053-C.5 0.5 ml
EUR 300.00

Rat Bone Marrow PrimaCell: Normal Hematopoietic Cells Growth Medium

9-25090 5 x 100 ml Ask for price

Mouse Bone Marrow PrimaCell: Normal Hematopoietic Cells Growth Medium

9-32094 5 x 100 ml Ask for price

UFPs have been discovered to change in vitro and in vivo responses of the immune system to allergens and may also play a task in allergen sensitization. The inflammatory properties of UFPs may be mediated by a quantity of totally different mechanisms, together with the power to provide reactive oxygen species, resulting in the era of proinflammatory cytokines and airway irritation.

In addition, as a result of of their small measurement, UFPs even have distinctive distribution traits in the respiratory tree and circulation and would possibly be capable of alter mobile perform in ways in which circumvent regular signaling pathways.

Additionally, UFPs can penetrate intracellularly and probably trigger DNA injury. The current advances in nanotechnology, though opening up new alternatives for the development of expertise and medication, may additionally result in unexpected hostile well being results in uncovered human topics.

Further analysis is required to make clear the protection of nanoscale particles, in addition to the elucidation of the doable helpful use of these particulates to deal with illness.

AllergoOncology: Microbiota in allergy and cancer-A European Academy for Allergy and Clinical Immunology position paper.

AllergoOncology: Microbiota in allergy and cancer-A European Academy for Allergy and Clinical Immunology position paper.
The microbiota can play necessary roles in the event of human immunity and the institution of immune homeostasis. Lifestyle elements together with food regimen, hygiene, and publicity to viruses or micro organism, and medical interventions with antibiotics or anti-ulcer medicines, regulate phylogenetic variability and the standard of cross speak between innate and adaptive immune cells through mucosal and pores and skin epithelia.
More just lately, microbiota and their composition have been linked to protecting results for well being. Imbalance, nonetheless, has been linked to immune-related ailments comparable to allergy and most cancers, characterised by impaired, or exaggerated immune tolerance, respectively.
In this AllergoOncology position paper, we give attention to the growing proof defining the microbiota composition as a key determinant of immunity and immune tolerance, linked to the chance for the event of allergic and malignant ailments. We focus on novel insights into the function of microbiota in illness and affected person responses to remedies in most cancers and in allergy.
These might spotlight alternatives to enhance affected person outcomes with medical interventions supported by way of a restored microbiome.
AllergoOncology: Microbiota in allergy and cancer-A European Academy for Allergy and Clinical Immunology position paper.
AllergoOncology: Microbiota in allergy and cancer-A European Academy for Allergy and Clinical Immunology position paper.

Quality standards in respiratory real-life effectiveness research: the REal Life EVidence AssessmeNt Tool (RELEVANT): report from the Respiratory Effectiveness Group-European Academy of Allergy and Clinical Immunology Task Force.

Quality standards in respiratory real-life effectiveness research: the REal Life EVidence AssessmeNt Tool (RELEVANT): report from the Respiratory Effectiveness Group-European Academy of Allergy and Clinical Immunology Task Force.

A Task Force was commissioned collectively by the European Academy of Allergy and Clinical Immunology (EAACI) and the Respiratory Effectiveness Group (REG) to develop a high quality evaluation device for real-life observational analysis to establish high-quality real-life bronchial asthma research that might be thought-about inside future guideline growth.The ensuing REal Life EVidence AssessmeNt Tool (RELEVANT) was achieved by way of an intensive evaluation of present initiatives in this space.

The first model was piloted amongst 9 raters throughout 6 articles; the revised, interim, model underwent in depth testing by 22 reviewers from the EAACI membership and REG collaborator group, resulting in additional revisions and device finalisation. RELEVANT was validated by way of an evaluation of real-life effectiveness research recognized by way of systematic evaluate of Medline and Embase databases and regarding subjects for which real-life research might provide priceless proof complementary to that from randomised managed trials.

The subjects have been chosen by way of a vote amongst Task Force members and associated to the affect of adherence, smoking, inhaler machine and particle measurement on bronchial asthma remedy effectiveness.Although highlighting a basic lack of high-quality real-life effectiveness observational analysis on these clinically vital subjects, the evaluation offered insights into how recognized observational research may inform bronchial asthma pointers builders and clinicians.

Overall, RELEVANT appeared dependable and straightforward to make use of by professional reviewers.Using such high quality appraisal instruments is obligatory to evaluate whether or not particular observational real-life effectiveness research can be utilized to tell guideline growth and/or decision-making in medical observe.

 Quality standards in respiratory real-life effectiveness research: the REal Life EVidence AssessmeNt Tool (RELEVANT): report from the Respiratory Effectiveness Group-European Academy of Allergy and Clinical Immunology Task Force.
Quality standards in respiratory real-life effectiveness analysis: the REal Life EVidence AssessmeNt Tool (RELEVANT): report from the Respiratory Effectiveness Group-European Academy of Allergy and Clinical Immunology Task Force.

New European Academy of Allergy and Clinical Immunology definition on pollen season mirrors symptom load for grass and birch pollen-induced allergic rhinitis.

The use of allergen immunotherapy (AIT) for allergic rhinitis and its medical efficacy in medical trials will depend on the efficient dedication of pollen allergen publicity time durations. We consider pollen information from Germany to look at the new definitions on pollen season and peak pollen interval begin and finish as proposed by the European Academy of Allergy and Clinical Immunology (EAACI) in a just lately printed Position Paper. The goal was to reveal the potential of these definitions to reflect symptom hundreds for grass and birch pollen-induced allergic rhinitis primarily based on real-life information.

FBXW7 Antibody

  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FBXW7. Recognizes FBXW7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

FBXW7 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW7. Recognizes FBXW7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

FBXW7 Antibody

DF12400 200ul
EUR 304.00
Description: FBXW7 antibody detects endogenous levels of FBXW7.

FBXW7 Antibody

  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FBXW7. Recognizes FBXW7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

FBXW7 antibody

70R-6541 50 ug
EUR 467.00
Description: Rabbit polyclonal FBXW7 antibody raised against the C terminal of FBXW7


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


YF-PA19671 50 ug
EUR 363.00
Description: Mouse polyclonal to FBXW7


YF-PA19672 100 ug
EUR 403.00
Description: Rabbit polyclonal to FBXW7


YF-PA26323 50 ul
EUR 334.00
Description: Mouse polyclonal to FBXW7

FBXW7 Blocking Peptide

33R-5108 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FBXW7 antibody, catalog no. 70R-6541

FBXW7 Blocking Peptide

DF12400-BP 1mg
EUR 195.00

FBXW7 cloning plasmid

CSB-CL822163HU-10ug 10ug
EUR 705.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2124
  • Sequence: atgaatcaggaactgctctctgtgggcagcaaaagacgacgaactggaggctctctgagaggtaacccttcctcaagccaggtagatgaagaacagatgaatcgtgtggtagaggaggaacagcaacagcaactcagacaacaagaggaggagcacactgcaaggaatggtgaag
  • Show more
Description: A cloning plasmid for the FBXW7 gene.

FBXW7 Rabbit pAb

A5872-100ul 100 ul
EUR 308.00

FBXW7 Rabbit pAb

A5872-200ul 200 ul
EUR 459.00

FBXW7 Rabbit pAb

A5872-20ul 20 ul
EUR 183.00

FBXW7 Rabbit pAb

A5872-50ul 50 ul
EUR 223.00

anti- FBXW7 antibody

FNab03057 100µg
EUR 585.00
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: F-box and WD repeat domain containing 7
  • Uniprot ID: Q969H0
  • Gene ID: 55294
  • Research Area: Immunology, Cardiovascular, Metabolism
Description: Antibody raised against FBXW7

Anti-FBXW7 antibody

PAab03057 100 ug
EUR 412.00

pDONR223-FBXW7 Plasmid

PVTB00367 2 ug
EUR 356.00

Anti-FBXW7 antibody

STJ29923 100 µl
EUR 277.00
Description: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene was previously referred to as FBX30, and belongs to the Fbws class; in addition to an F-box, this protein contains 7 tandem WD40 repeats. This protein binds directly to cyclin E and probably targets cyclin E for ubiquitin-mediated degradation. Mutations in this gene are detected in ovarian and breast cancer cell lines, implicating the gene's potential role in the pathogenesis of human cancers. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-FBXW7 (3D1)

YF-MA11557 100 ug
EUR 363.00
Description: Mouse monoclonal to FBXW7

Anti-Fbxw7 (1C11)

YF-MA18764 100 ug
EUR 363.00
Description: Mouse monoclonal to Fbxw7

FBXW7 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW7. Recognizes FBXW7 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FBXW7 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW7. Recognizes FBXW7 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FBXW7 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW7. Recognizes FBXW7 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA


EF009598 96 Tests
EUR 689.00

Mouse FBXW7 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human FBXW7 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

pECMV- 3*Flag- FBXW7

PVT10356 2 ug
EUR 301.00

FBXW7 Recombinant Protein (Human)

RP039052 100 ug Ask for price

FBXW7 Recombinant Protein (Mouse)

RP134159 100 ug Ask for price

FBXW7 Recombinant Protein (Mouse)

RP134162 100 ug Ask for price

FBXW7 Recombinant Protein (Mouse)

RP134165 100 ug Ask for price

Polyclonal Fbxw7 antibody - middle region

APR00709G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Fbxw7 - middle region. This antibody is tested and proven to work in the following applications:

FBXW7 ORF Vector (Human) (pORF)

ORF013018 1.0 ug DNA
EUR 95.00

Fbxw7 ORF Vector (Mouse) (pORF)

ORF044721 1.0 ug DNA
EUR 506.00

Fbxw7 ORF Vector (Mouse) (pORF)

ORF044722 1.0 ug DNA
EUR 506.00

Fbxw7 ORF Vector (Mouse) (pORF)

ORF044723 1.0 ug DNA
EUR 506.00

Polyclonal FBXW7 / FBW7 Antibody (N-Terminus)

APR02668G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FBXW7 / FBW7 (N-Terminus). This antibody is tested and proven to work in the following applications:

FBXW7 sgRNA CRISPR Lentivector set (Human)

K0767601 3 x 1.0 ug
EUR 339.00

Fbxw7 sgRNA CRISPR Lentivector set (Mouse)

K4531701 3 x 1.0 ug
EUR 339.00

Monoclonal FBXW7 Antibody (monoclonal) (M02), Clone: 3D1

AMM03534G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human FBXW7 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 3D1. This antibody is applicable in WB and IHC, E

FBXW7 sgRNA CRISPR Lentivector (Human) (Target 1)

K0767602 1.0 ug DNA
EUR 154.00

FBXW7 sgRNA CRISPR Lentivector (Human) (Target 2)

K0767603 1.0 ug DNA
EUR 154.00

FBXW7 sgRNA CRISPR Lentivector (Human) (Target 3)

K0767604 1.0 ug DNA
EUR 154.00

Fbxw7 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4531702 1.0 ug DNA
EUR 154.00

Fbxw7 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4531703 1.0 ug DNA
EUR 154.00

Fbxw7 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4531704 1.0 ug DNA
EUR 154.00

FBXW7 Protein Vector (Mouse) (pPB-C-His)

PV178882 500 ng
EUR 1065.00

FBXW7 Protein Vector (Mouse) (pPB-N-His)

PV178883 500 ng
EUR 1065.00

FBXW7 Protein Vector (Mouse) (pPM-C-HA)

PV178884 500 ng
EUR 1065.00

FBXW7 Protein Vector (Mouse) (pPM-C-His)

PV178885 500 ng
EUR 1065.00

FBXW7 Protein Vector (Mouse) (pPB-C-His)

PV178886 500 ng
EUR 1065.00

FBXW7 Protein Vector (Mouse) (pPB-N-His)

PV178887 500 ng
EUR 1065.00

FBXW7 Protein Vector (Mouse) (pPM-C-HA)

PV178888 500 ng
EUR 1065.00

FBXW7 Protein Vector (Mouse) (pPM-C-His)

PV178889 500 ng
EUR 1065.00

FBXW7 Protein Vector (Mouse) (pPB-C-His)

PV178890 500 ng
EUR 603.00

FBXW7 Protein Vector (Mouse) (pPB-N-His)

PV178891 500 ng
EUR 603.00

FBXW7 Protein Vector (Mouse) (pPM-C-HA)

PV178892 500 ng
EUR 603.00

FBXW7 Protein Vector (Mouse) (pPM-C-His)

PV178893 500 ng
EUR 603.00

FBXW7 Protein Vector (Human) (pPB-C-His)

PV052069 500 ng
EUR 481.00

FBXW7 Protein Vector (Human) (pPB-N-His)

PV052070 500 ng
EUR 481.00

FBXW7 Protein Vector (Human) (pPM-C-HA)

PV052071 500 ng
EUR 481.00

FBXW7 Protein Vector (Human) (pPM-C-His)

PV052072 500 ng
EUR 481.00

Fbxw7 3'UTR GFP Stable Cell Line

TU156466 1.0 ml Ask for price

Fbxw7 3'UTR Luciferase Stable Cell Line

TU106466 1.0 ml Ask for price

FBXW7 3'UTR GFP Stable Cell Line

TU057813 1.0 ml
EUR 1521.00

FBXW7 3'UTR Luciferase Stable Cell Line

TU007813 1.0 ml
EUR 1521.00

Human F-box/WD repeat-containing protein 7 (FBXW7)

  • EUR 965.00
  • EUR 665.00
  • EUR 715.00
  • 0
  • 1
  • 2
  • MW: 83.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human F-box/WD repeat-containing protein 7(FBXW7) expressed in in vitro E.coli expression system

F-Box And WD Repeat Domain Containing 7 (FBXW7) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 7 (FBXW7) Antibody

  • EUR 411.00
  • EUR 592.00
  • 0
  • 1
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 7 (FBXW7) Antibody

abx145824-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 7 (FBXW7) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 7 (FBXW7) Antibody

abx233057-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.

FBXW7 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0767605 3 x 1.0 ug
EUR 376.00

Fbxw7 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4531705 3 x 1.0 ug
EUR 376.00

Rat F box/WD repeat containing protein 7(FBXW7) ELISA kit

E02F0338-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat F box/WD repeat containing protein 7(FBXW7) ELISA kit

E02F0338-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat F box/WD repeat containing protein 7(FBXW7) ELISA kit

E02F0338-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F box/WD repeat containing protein 7(FBXW7) ELISA kit

E03F0338-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F box/WD repeat containing protein 7(FBXW7) ELISA kit

E03F0338-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F box/WD repeat containing protein 7(FBXW7) ELISA kit

E03F0338-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit F box/WD repeat containing protein 7(FBXW7) ELISA kit

E04F0338-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit F box/WD repeat containing protein 7(FBXW7) ELISA kit

E04F0338-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit F box/WD repeat containing protein 7(FBXW7) ELISA kit

E04F0338-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human F box/WD repeat containing protein 7(FBXW7) ELISA kit

E01F0338-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human F box/WD repeat containing protein 7(FBXW7) ELISA kit

E01F0338-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human F box/WD repeat containing protein 7(FBXW7) ELISA kit

E01F0338-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat F box/WD repeat containing protein 7(FBXW7) ELISA kit

E06F0338-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat F box/WD repeat containing protein 7(FBXW7) ELISA kit

E06F0338-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat F box/WD repeat containing protein 7(FBXW7) ELISA kit

E06F0338-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Antibody

  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Antibody

  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Monkey F box/WD repeat containing protein 7(FBXW7) ELISA kit

E09F0338-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey F box/WD repeat containing protein 7(FBXW7) ELISA kit

E09F0338-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey F box/WD repeat containing protein 7(FBXW7) ELISA kit

E09F0338-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog F box/WD repeat containing protein 7(FBXW7) ELISA kit

E08F0338-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog F box/WD repeat containing protein 7(FBXW7) ELISA kit

E08F0338-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog F box/WD repeat containing protein 7(FBXW7) ELISA kit

E08F0338-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F- box/WD repeat- containing protein 7, Fbxw7 ELISA KIT

ELI-20808m 96 Tests
EUR 865.00

Human F- box/WD repeat- containing protein 7, FBXW7 ELISA KIT

ELI-27065h 96 Tests
EUR 824.00

Pig F box/WD repeat containing protein 7(FBXW7) ELISA kit

E07F0338-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig F box/WD repeat containing protein 7(FBXW7) ELISA kit

E07F0338-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig F box/WD repeat containing protein 7(FBXW7) ELISA kit

E07F0338-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

F-Box And WD Repeat Domain Containing 7 (FBXW7) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 7 (FBXW7) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 7 (FBXW7) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

FBXW7 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0767606 1.0 ug DNA
EUR 167.00

FBXW7 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0767607 1.0 ug DNA
EUR 167.00

FBXW7 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0767608 1.0 ug DNA
EUR 167.00

Fbxw7 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4531706 1.0 ug DNA
EUR 167.00

Fbxw7 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4531707 1.0 ug DNA
EUR 167.00

Fbxw7 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4531708 1.0 ug DNA
EUR 167.00

Recombinant F-Box And WD Repeat Domain Containing Protein 7 (FBXW7)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: Q969H0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.0kDa
  • Isoelectric Point: 9.3
Description: Recombinant Human F-Box And WD Repeat Domain Containing Protein 7 expressed in: E.coli

Recombinant F-Box And WD Repeat Domain Containing Protein 7 (FBXW7)

  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: Q8VBV4
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.6kDa
  • Isoelectric Point: 7.3
Description: Recombinant Mouse F-Box And WD Repeat Domain Containing Protein 7 expressed in: E.coli

Guinea pig F box/WD repeat containing protein 7(FBXW7) ELISA kit

E05F0338-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig F box/WD repeat containing protein 7(FBXW7) ELISA kit

E05F0338-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig F box/WD repeat containing protein 7(FBXW7) ELISA kit

E05F0338-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Mouse F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Protein

  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Human F-Box and WD Repeat Domain Containing 7 (FBXW7) ELISA Kit

abx387334-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

F-box and WD-40 domain protein 7 isoform 1 (FBXW7) polyclonal antibody

ABP-PAB-10563 100 ug Ask for price
    • Product line: Transcription Factors
    • Brand:

F-box and WD-40 domain protein 7 isoform 2 (FBXW7) polyclonal antibody

ABP-PAB-10564 100 ug Ask for price
    • Product line: Transcription Factors
    • Brand:

F-box and WD-40 domain protein 7 isoform 2 (FBXW7) polyclonal antibody

ABP-PAB-10565 100 ug Ask for price
    • Product line: Transcription Factors
    • Brand:

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: FBXW7 (Asp279~Val515)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human F-Box And WD Repeat Domain Containing Protein 7 (FBXW7)

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Polyclonal Antibody (Mouse)
