GenMark ePlex NATtrol

In March, GenMark received EUA for its ePlex SARS-CoV-2 Test. Respiratory Pathogen Panel. Multiplex molecular diagnostic solutions provider GenMark Diagnostics has secured CE mark approval for its ePlex respiratory pathogen panel 2 (RP2). The ePlex RP has received FDA clearance for nasopharyngeal swab (NPS) specimens collected in viral transport media. COVID-19. ;

The RP2 Panel provides results in less than two hours for more than 20 viruses and bacteria that cause common respiratory infections with similar symptoms, including COVID-19, flu, bronchitis, and the common cold. Clinical implications of rapid eplex® respiratory pathogen panel testing compared to laboratory-developed real-time PCR Anneloes L. van Rijn, Roel H.T. Due to the batch-wise testing, laboratory-developed real-time polymerase chain reaction (PCR) assays (LDT) often result in a time to result of one day.

10/01/2019: Under Article Text added the third bullet point verbiage “For dates of service on or after 10/1/2019, laboratories billing for services using GenMark” ePlex Respiratory Pathogen (RP) Panel should report 0115U. The ePlex RP2 Control M451 is composed of synthetic DNA and RNA specifically designed for and intended to be used solely with the ePlex RP2 Panel on the ePlex System. In March, GenMark received EUA for its ePlex SARS-CoV-2 Test. Read More.

The ePlex respiratory pathogen panel (RP panel) is a novel molecular biology-based assay, developed by GenMark Diagnostics, Inc. (Carlsbad, CA), to be performed within a single cartridge for the diagnosis of 25 respiratory pathogens (viral and bacterial). in Top News. GenMarkâs ePLex-BCID Gram-Positive panel detects 20 bacterial targets, and the Fungal Pathogen panel detects 13 yeast pathogens in one and a half hours. AB Molecular Ltd. Butyl Road, Botolph Claydon, Respiratory Pathogen Panel. AB Molecular is the exclusive distributor in the UK for GenMark Dx and has been established to promote their innovative ePlex technology.

The ePlex RP2 Panel is designed for use with the companyâs ePlex system, which has been cleared by the FDA for use with the ePlex Respiratory Pathogen (RP) Panel and Blood Culture Identification (BCID) Panels (Gram-positive, Gram-negative and Fungal pathogens). The QIAstat-Dx® RP assay detected 312 of the 338 respiratory targets (92%) that were detected by the ePlex® RPP assay. This assay does NOT detect SARS CoV-2 (novel coronavirus) or MERS. Multiplex molecular panels provide high sensitivity (few false negatives) and specificity (few false positives) for multiple pathogens in ⦠GenMarkâs ePlex Respiratory Pathogen Panel 2 (RP2) achieves CE mark.

The company said RP2 drove the majority of the placements and revenues in Q3. Respiratory Panel 2 (RP2)] 0115U Respiratory infectious agent detection by nucleic acid (DNA and RNA), 18 viral types and subtypes and 2 bacterial targets, amplified probe technique, including multiplex reverse transcription for RNA targets, each analyte reported as detected or not detected [USE FOR GenMark ePlex Respiratory Pathogen (RP) Panel] SARS-CoV-2 (2 assays) Seasonal coronavirus.

We are very pleased to announce the 510(k) clearance of ePlex and the Respiratory Pathogen Panel. The new RP2 panel includes SARS-CoV-2, the pathogen that causes COVID-19. If the tube system is used, ensure specimens are in leak-proof containers that are securely closed and double bagged. ORIGINAL ARTICLE Clinical implications of rapid ePlex® Respiratory Pathogen Panel testing compared to laboratory-developed real-time PCR Anneloes L. van Rijn1 & Roel H. T. Nijhuis1 & Vincent Bekker 2 & Geert H.

Multi-morbidities of allergic rhinitis in adults: European Academy of Allergy and Clinical Immunology Task Force Report.

Multi-morbidities of allergic rhinitis in adults: European Academy of Allergy and Clinical Immunology Task Force Report.

This report has been ready by the European Academy of Allergy and Clinical Immunology Task Force on Allergic Rhinitis (AR) comorbidities. The goal of this multidisciplinary European consensus doc is to spotlight the function of multimorbidities in the definition, classification, mechanisms, suggestions for prognosis and remedy of AR, and to outline the wants in this uncared for space by a literature overview.

AR is a systemic allergic illness and is mostly related to quite a few multi-morbid problems, together with bronchial asthma, eczema, meals allergic reactions, eosinophilic oesophagitis (EoE), conjunctivitis, power center ear effusions, rhinosinusitis, adenoid hypertrophy, olfaction problems, obstructive sleep apnea, disordered sleep and consequent behavioural and instructional results.

This report supplies up-to-date usable data to: (1) enhance the data and expertise of allergists, in order to in the end enhance the general high quality of affected person care; (2) to extend curiosity in this space; and (3) to current a singular contribution to the sphere of higher inflammatory illness.

 Multi-morbidities of allergic rhinitis in adults: European Academy of Allergy and Clinical Immunology Task Force Report.
Multi-morbidities of allergic rhinitis in adults: European Academy of Allergy and Clinical Immunology Task Force Report.

A piece group report on ultrafine particles (American Academy of Allergy, Asthma & Immunology): Why ambient ultrafine and engineered nanoparticles ought to obtain particular consideration for doable hostile well being outcomes in human topics.

Ultrafine particles (UFPs) are airborne particulates of lower than 100 nm in aerodynamic diameter. Examples of UFPs are diesel exhaust particles, merchandise of cooking, heating, and wooden burning in indoor environments, and, extra not too long ago, merchandise generated by the use of nanotechnology. Studies have proven that ambient UFPs have detrimental results on each the cardiovascular and respiratory techniques, together with the next incidence of atherosclerosis and exacerbation fee of bronchial asthma.

Human Mesenchymal Stem Cells

SC00A1 500000
EUR 905

anti-CD34 Hematopoietic precursor cells

513-A-01mg 0,1 mg
EUR 267.5
  • Category: Antibody, Signal Transduction Antibodies, mAb
Description: anti-CD34 Hematopoietic precursor cells

anti-CD34 Hematopoietic precursor cells

513-A-1000ug 1000 ug
EUR 1282.5
  • Category: Antibody, Signal Transduction Antibodies, mAb
Description: anti-CD34 Hematopoietic precursor cells

Mouse Bone Marrow PrimaCell: Hematopoietic Cells

2-82094 1 Kit Ask for price

Rat Bone Marrow PrimaCell: Hematopoietic Cells

2-82590 1 Kit Ask for price

Human Bone Marrow PrimaCell: Hematopoietic Cells

2-96116 1 Kit Ask for price

Mesenchymal Stem Cells - Adipose Derived

SC00AD1 500,000 Cells
EUR 905

Mesenchymal Stem Cells - Placental Derived

SC00P1 500,000 cells
EUR 905

Neural Stem Cells (iPSC from Blood Cells; Male)

ASE-9234 1 vial (1 x 10^6)
EUR 414.5
Description: 12 month

Neural Stem Cells (iPSC from Blood Cells; Female)

ASE-9234F 1 vial (1 x 10^6)
EUR 414.5
Description: 12 month

Human Neural Stem Cells Differentiation Kit

abx298022-100ml 100 ml
EUR 314
  • Shipped within 5-10 working days.

Human Neural Stem Cells Expansion Kit

abx298023-1Kit 1 Kit
EUR 272
  • Shipped within 5-10 working days.

Mesenchymal Stem Cells - Bone Marrow Derived

SC00BM1 500,000 cells
EUR 905

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNCR2185-250 250uL
EUR 394
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), RPE conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNCR2598-250 250uL
EUR 394
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), RPE conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNUB2185-100 100uL
EUR 264
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), Concentration: 0.2mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNUB2185-50 50uL
EUR 405
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), 1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNUB2185-500 500uL
EUR 513
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), Concentration: 0.2mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNUB2598-100 100uL
EUR 264
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), Concentration: 0.2mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNUB2598-50 50uL
EUR 405
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), 1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNUB2598-500 500uL
EUR 513
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), Concentration: 0.2mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC552185-100 100uL
EUR 233
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF555 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC552185-500 500uL
EUR 545
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF555 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC552598-100 100uL
EUR 233
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF555 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC552598-500 500uL
EUR 545
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF555 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC612185-100 100uL
EUR 233
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF660R conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC612185-500 500uL
EUR 545
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF660R conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC432185-100 100uL
EUR 233
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF543 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC432185-500 500uL
EUR 545
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF543 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC432598-100 100uL
EUR 233
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF543 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC432598-500 500uL
EUR 545
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF543 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC472185-100 100uL
EUR 233
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF647 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC472185-500 500uL
EUR 545
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF647 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC472598-100 100uL
EUR 233
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF647 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC472598-500 500uL
EUR 545
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF647 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC042185-100 100uL
EUR 233
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF405S conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC042185-500 500uL
EUR 545
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF405S conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC042598-100 100uL
EUR 233
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF405S conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC042598-500 500uL
EUR 545
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF405S conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC052185-100 100uL
EUR 233
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF405M conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC052185-500 500uL
EUR 545
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF405M conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC052598-100 100uL
EUR 233
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF405M conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC052598-500 500uL
EUR 545
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF405M conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC402185-100 100uL
EUR 233
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF640R conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC402185-500 500uL
EUR 545
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF640R conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC402598-100 100uL
EUR 233
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF640R conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC402598-500 500uL
EUR 545
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF640R conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC702185-100 100uL
EUR 233
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF770 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC702185-500 500uL
EUR 545
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF770 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC702598-100 100uL
EUR 233
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF770 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC702598-500 500uL
EUR 545
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF770 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC802185-100 100uL
EUR 233
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF680 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC802185-500 500uL
EUR 545
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF680 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC802598-100 100uL
EUR 233
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF680 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC802598-500 500uL
EUR 545
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF680 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNCH2185-100 100uL
EUR 233
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNCH2185-500 500uL
EUR 545
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNCH2598-100 100uL
EUR 233
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNCH2598-500 500uL
EUR 545
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNCP2185-250 250uL
EUR 394
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), PerCP conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNCP2598-250 250uL
EUR 394
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), PerCP conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC942185-100 100uL
EUR 233
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF594 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC942185-500 500uL
EUR 545
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF594 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC942598-100 100uL
EUR 233
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF594 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC942598-500 500uL
EUR 545
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF594 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNCA2185-250 250uL
EUR 394
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), APC conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNCA2598-250 250uL
EUR 394
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), APC conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNCB2185-100 100uL
EUR 233
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), Biotin conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNCB2185-500 500uL
EUR 545
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), Biotin conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNCB2598-100 100uL
EUR 233
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), Biotin conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNCB2598-500 500uL
EUR 545
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), Biotin conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC882185-100 100uL
EUR 233
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF488A conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC882185-500 500uL
EUR 545
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF488A conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC882598-100 100uL
EUR 233
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF488A conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC882598-500 500uL
EUR 545
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF488A conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC682185-100 100uL
EUR 233
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF568 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC682185-500 500uL
EUR 545
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF568 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC682598-100 100uL
EUR 233
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF568 conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC682598-500 500uL
EUR 545
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF568 conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNCAP2185-100 100uL
EUR 233
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNCAP2185-500 500uL
EUR 545
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNCAP2598-100 100uL
EUR 233
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNCAP2598-500 500uL
EUR 545
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC812185-100 100uL
EUR 233
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF680R conjugate, Concentration: 0.1mg/mL

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185) Antibody

BNC812185-500 500uL
EUR 545
Description: Primary antibody against Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) (PODXL/2185), CF680R conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC812598-100 100uL
EUR 233
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF680R conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC812598-500 500uL
EUR 545
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF680R conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC612598-100 100uL
EUR 233
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF660R conjugate, Concentration: 0.1mg/mL

CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R) Antibody

BNC612598-500 500uL
EUR 545
Description: Primary antibody against CD34 (Hematopoietic Stem Cell & Endothelial Marker) (HPCA1/2598R), CF660R conjugate, Concentration: 0.1mg/mL

Anti-Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) Monoclonal Antibody

M03359 100ug/vial
EUR 397
Description: Mouse Monoclonal Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker) Antibody. Validated in Flow Cytometry, IP and tested in Human, Rabbit, Rat.

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker); Clone 3D3 (Concentrate)

RA0264-C.1 0.1 ml
EUR 125

Podocalyxin (PODXL) (Hematopoietic Stem Cell Marker); Clone 3D3 (Concentrate)

RA0264-C.5 0.5 ml
EUR 300

Human Bone Marrow CD34+ Stem Cells, Cryopreserved


Human Bone Marrow CD34+ Stem Cells, Cryopreserved


Human Bone Marrow CD34+ Stem Cells, Cryopreserved


Human Bone Marrow CD34+ Stem Cells, Fresh


Human Bone Marrow CD34+ Stem Cells, Fresh


Human Mesenchymal Stem Cells - Bone Marrow Derived

MSC001 500,000+ Cells
EUR 1288

Human Mesenchymal Stem Cells-Green Fluorescent-Labeled

SC00A2 500000
EUR 962

UFPs have been discovered to change in vitro and in vivo responses of the immune system to allergens and may also play a task in allergen sensitization. The inflammatory properties of UFPs may be mediated by a quantity of totally different mechanisms, together with the power to provide reactive oxygen species, resulting in the era of proinflammatory cytokines and airway irritation.

In addition, as a result of of their small measurement, UFPs even have distinctive distribution traits in the respiratory tree and circulation and would possibly be capable of alter mobile perform in ways in which circumvent regular signaling pathways.

Additionally, UFPs can penetrate intracellularly and probably trigger DNA injury. The current advances in nanotechnology, though opening up new alternatives for the development of expertise and medication, may additionally result in unexpected hostile well being results in uncovered human topics.

Further analysis is required to make clear the protection of nanoscale particles, in addition to the elucidation of the doable helpful use of these particulates to deal with illness.

AllergoOncology: Microbiota in allergy and cancer-A European Academy for Allergy and Clinical Immunology position paper.

AllergoOncology: Microbiota in allergy and cancer-A European Academy for Allergy and Clinical Immunology position paper.
The microbiota can play necessary roles in the event of human immunity and the institution of immune homeostasis. Lifestyle elements together with food regimen, hygiene, and publicity to viruses or micro organism, and medical interventions with antibiotics or anti-ulcer medicines, regulate phylogenetic variability and the standard of cross speak between innate and adaptive immune cells through mucosal and pores and skin epithelia.
More just lately, microbiota and their composition have been linked to protecting results for well being. Imbalance, nonetheless, has been linked to immune-related ailments comparable to allergy and most cancers, characterised by impaired, or exaggerated immune tolerance, respectively.
In this AllergoOncology position paper, we give attention to the growing proof defining the microbiota composition as a key determinant of immunity and immune tolerance, linked to the chance for the event of allergic and malignant ailments. We focus on novel insights into the function of microbiota in illness and affected person responses to remedies in most cancers and in allergy.
These might spotlight alternatives to enhance affected person outcomes with medical interventions supported by way of a restored microbiome.
AllergoOncology: Microbiota in allergy and cancer-A European Academy for Allergy and Clinical Immunology position paper.
AllergoOncology: Microbiota in allergy and cancer-A European Academy for Allergy and Clinical Immunology position paper.

Quality standards in respiratory real-life effectiveness research: the REal Life EVidence AssessmeNt Tool (RELEVANT): report from the Respiratory Effectiveness Group-European Academy of Allergy and Clinical Immunology Task Force.

Quality standards in respiratory real-life effectiveness research: the REal Life EVidence AssessmeNt Tool (RELEVANT): report from the Respiratory Effectiveness Group-European Academy of Allergy and Clinical Immunology Task Force.

A Task Force was commissioned collectively by the European Academy of Allergy and Clinical Immunology (EAACI) and the Respiratory Effectiveness Group (REG) to develop a high quality evaluation device for real-life observational analysis to establish high-quality real-life bronchial asthma research that might be thought-about inside future guideline growth.The ensuing REal Life EVidence AssessmeNt Tool (RELEVANT) was achieved by way of an intensive evaluation of present initiatives in this space.

The first model was piloted amongst 9 raters throughout 6 articles; the revised, interim, model underwent in depth testing by 22 reviewers from the EAACI membership and REG collaborator group, resulting in additional revisions and device finalisation. RELEVANT was validated by way of an evaluation of real-life effectiveness research recognized by way of systematic evaluate of Medline and Embase databases and regarding subjects for which real-life research might provide priceless proof complementary to that from randomised managed trials.

The subjects have been chosen by way of a vote amongst Task Force members and associated to the affect of adherence, smoking, inhaler machine and particle measurement on bronchial asthma remedy effectiveness.Although highlighting a basic lack of high-quality real-life effectiveness observational analysis on these clinically vital subjects, the evaluation offered insights into how recognized observational research may inform bronchial asthma pointers builders and clinicians.

Overall, RELEVANT appeared dependable and straightforward to make use of by professional reviewers.Using such high quality appraisal instruments is obligatory to evaluate whether or not particular observational real-life effectiveness research can be utilized to tell guideline growth and/or decision-making in medical observe.

 Quality standards in respiratory real-life effectiveness research: the REal Life EVidence AssessmeNt Tool (RELEVANT): report from the Respiratory Effectiveness Group-European Academy of Allergy and Clinical Immunology Task Force.
Quality standards in respiratory real-life effectiveness analysis: the REal Life EVidence AssessmeNt Tool (RELEVANT): report from the Respiratory Effectiveness Group-European Academy of Allergy and Clinical Immunology Task Force.

New European Academy of Allergy and Clinical Immunology definition on pollen season mirrors symptom load for grass and birch pollen-induced allergic rhinitis.

The use of allergen immunotherapy (AIT) for allergic rhinitis and its medical efficacy in medical trials will depend on the efficient dedication of pollen allergen publicity time durations. We consider pollen information from Germany to look at the new definitions on pollen season and peak pollen interval begin and finish as proposed by the European Academy of Allergy and Clinical Immunology (EAACI) in a just lately printed Position Paper. The goal was to reveal the potential of these definitions to reflect symptom hundreds for grass and birch pollen-induced allergic rhinitis primarily based on real-life information.

FBXW7 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FBXW7. Recognizes FBXW7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

FBXW7 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW7. Recognizes FBXW7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

FBXW7 Antibody

DF12400 200ul
EUR 304
Description: FBXW7 antibody detects endogenous levels of FBXW7.

FBXW7 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FBXW7. Recognizes FBXW7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

FBXW7 antibody

70R-6541 50 ug
EUR 467
Description: Rabbit polyclonal FBXW7 antibody raised against the C terminal of FBXW7


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA19671 50 ug
EUR 363
Description: Mouse polyclonal to FBXW7


YF-PA19672 100 ug
EUR 403
Description: Rabbit polyclonal to FBXW7


YF-PA26323 50 ul
EUR 334
Description: Mouse polyclonal to FBXW7

FBXW7 Blocking Peptide

33R-5108 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FBXW7 antibody, catalog no. 70R-6541

FBXW7 Blocking Peptide

DF12400-BP 1mg
EUR 195

FBXW7 cloning plasmid

CSB-CL822163HU-10ug 10ug
EUR 705
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2124
  • Sequence: atgaatcaggaactgctctctgtgggcagcaaaagacgacgaactggaggctctctgagaggtaacccttcctcaagccaggtagatgaagaacagatgaatcgtgtggtagaggaggaacagcaacagcaactcagacaacaagaggaggagcacactgcaaggaatggtgaag
  • Show more
Description: A cloning plasmid for the FBXW7 gene.

FBXW7 Rabbit pAb

A5872-100ul 100 ul
EUR 308

FBXW7 Rabbit pAb

A5872-200ul 200 ul
EUR 459

FBXW7 Rabbit pAb

A5872-20ul 20 ul
EUR 183

FBXW7 Rabbit pAb

A5872-50ul 50 ul
EUR 223

anti- FBXW7 antibody

FNab03057 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: F-box and WD repeat domain containing 7
  • Uniprot ID: Q969H0
  • Gene ID: 55294
  • Research Area: Immunology, Cardiovascular, Metabolism
Description: Antibody raised against FBXW7

Anti-FBXW7 antibody

PAab03057 100 ug
EUR 412

pDONR223-FBXW7 Plasmid

PVTB00367 2 ug
EUR 356

Anti-FBXW7 antibody

STJ29923 100 µl
EUR 277
Description: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene was previously referred to as FBX30, and belongs to the Fbws class; in addition to an F-box, this protein contains 7 tandem WD40 repeats. This protein binds directly to cyclin E and probably targets cyclin E for ubiquitin-mediated degradation. Mutations in this gene are detected in ovarian and breast cancer cell lines, implicating the gene's potential role in the pathogenesis of human cancers. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-FBXW7 (3D1)

YF-MA11557 100 ug
EUR 363
Description: Mouse monoclonal to FBXW7

Anti-Fbxw7 (1C11)

YF-MA18764 100 ug
EUR 363
Description: Mouse monoclonal to Fbxw7

FBXW7 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW7. Recognizes FBXW7 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FBXW7 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW7. Recognizes FBXW7 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FBXW7 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW7. Recognizes FBXW7 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA


EF009598 96 Tests
EUR 689

Mouse FBXW7 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FBXW7 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pECMV- 3*Flag- FBXW7

PVT10356 2 ug
EUR 301

FBXW7 Recombinant Protein (Human)

RP039052 100 ug Ask for price

FBXW7 Recombinant Protein (Mouse)

RP134159 100 ug Ask for price

FBXW7 Recombinant Protein (Mouse)

RP134162 100 ug Ask for price

FBXW7 Recombinant Protein (Mouse)

RP134165 100 ug Ask for price

Polyclonal Fbxw7 antibody - middle region

APR00709G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Fbxw7 - middle region. This antibody is tested and proven to work in the following applications:

FBXW7 ORF Vector (Human) (pORF)

ORF013018 1.0 ug DNA
EUR 95

Fbxw7 ORF Vector (Mouse) (pORF)

ORF044721 1.0 ug DNA
EUR 506

Fbxw7 ORF Vector (Mouse) (pORF)

ORF044722 1.0 ug DNA
EUR 506

Fbxw7 ORF Vector (Mouse) (pORF)

ORF044723 1.0 ug DNA
EUR 506

Polyclonal FBXW7 / FBW7 Antibody (N-Terminus)

APR02668G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FBXW7 / FBW7 (N-Terminus). This antibody is tested and proven to work in the following applications:

FBXW7 sgRNA CRISPR Lentivector set (Human)

K0767601 3 x 1.0 ug
EUR 339

Fbxw7 sgRNA CRISPR Lentivector set (Mouse)

K4531701 3 x 1.0 ug
EUR 339

Monoclonal FBXW7 Antibody (monoclonal) (M02), Clone: 3D1

AMM03534G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human FBXW7 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 3D1. This antibody is applicable in WB and IHC, E

FBXW7 sgRNA CRISPR Lentivector (Human) (Target 1)

K0767602 1.0 ug DNA
EUR 154

FBXW7 sgRNA CRISPR Lentivector (Human) (Target 2)

K0767603 1.0 ug DNA
EUR 154

FBXW7 sgRNA CRISPR Lentivector (Human) (Target 3)

K0767604 1.0 ug DNA
EUR 154

Fbxw7 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4531702 1.0 ug DNA
EUR 154

Fbxw7 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4531703 1.0 ug DNA
EUR 154

Fbxw7 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4531704 1.0 ug DNA
EUR 154

FBXW7 Protein Vector (Mouse) (pPB-C-His)

PV178882 500 ng
EUR 1065

FBXW7 Protein Vector (Mouse) (pPB-N-His)

PV178883 500 ng
EUR 1065

FBXW7 Protein Vector (Mouse) (pPM-C-HA)

PV178884 500 ng
EUR 1065

FBXW7 Protein Vector (Mouse) (pPM-C-His)

PV178885 500 ng
EUR 1065

FBXW7 Protein Vector (Mouse) (pPB-C-His)

PV178886 500 ng
EUR 1065

FBXW7 Protein Vector (Mouse) (pPB-N-His)

PV178887 500 ng
EUR 1065

FBXW7 Protein Vector (Mouse) (pPM-C-HA)

PV178888 500 ng
EUR 1065

FBXW7 Protein Vector (Mouse) (pPM-C-His)

PV178889 500 ng
EUR 1065

FBXW7 Protein Vector (Mouse) (pPB-C-His)

PV178890 500 ng
EUR 603

FBXW7 Protein Vector (Mouse) (pPB-N-His)

PV178891 500 ng
EUR 603

FBXW7 Protein Vector (Mouse) (pPM-C-HA)

PV178892 500 ng
EUR 603

FBXW7 Protein Vector (Mouse) (pPM-C-His)

PV178893 500 ng
EUR 603

FBXW7 Protein Vector (Human) (pPB-C-His)

PV052069 500 ng
EUR 481

FBXW7 Protein Vector (Human) (pPB-N-His)

PV052070 500 ng
EUR 481

FBXW7 Protein Vector (Human) (pPM-C-HA)

PV052071 500 ng
EUR 481

FBXW7 Protein Vector (Human) (pPM-C-His)

PV052072 500 ng
EUR 481

Fbxw7 3'UTR GFP Stable Cell Line

TU156466 1.0 ml Ask for price

Fbxw7 3'UTR Luciferase Stable Cell Line

TU106466 1.0 ml Ask for price

FBXW7 3'UTR GFP Stable Cell Line

TU057813 1.0 ml
EUR 1521

FBXW7 3'UTR Luciferase Stable Cell Line

TU007813 1.0 ml
EUR 1521

Human F-box/WD repeat-containing protein 7 (FBXW7)

  • EUR 965.00
  • EUR 665.00
  • EUR 715.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 83.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human F-box/WD repeat-containing protein 7(FBXW7) expressed in in vitro E.coli expression system

F-Box And WD Repeat Domain Containing 7 (FBXW7) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 7 (FBXW7) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 7 (FBXW7) Antibody

abx145824-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 7 (FBXW7) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 7 (FBXW7) Antibody

abx233057-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

FBXW7 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0767605 3 x 1.0 ug
EUR 376

Fbxw7 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4531705 3 x 1.0 ug
EUR 376

Rat F box/WD repeat containing protein 7(FBXW7) ELISA kit

E02F0338-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat F box/WD repeat containing protein 7(FBXW7) ELISA kit

E02F0338-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat F box/WD repeat containing protein 7(FBXW7) ELISA kit

E02F0338-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F box/WD repeat containing protein 7(FBXW7) ELISA kit

E03F0338-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F box/WD repeat containing protein 7(FBXW7) ELISA kit

E03F0338-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F box/WD repeat containing protein 7(FBXW7) ELISA kit

E03F0338-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit F box/WD repeat containing protein 7(FBXW7) ELISA kit

E04F0338-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit F box/WD repeat containing protein 7(FBXW7) ELISA kit

E04F0338-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit F box/WD repeat containing protein 7(FBXW7) ELISA kit

E04F0338-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human F box/WD repeat containing protein 7(FBXW7) ELISA kit

E01F0338-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human F box/WD repeat containing protein 7(FBXW7) ELISA kit

E01F0338-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human F box/WD repeat containing protein 7(FBXW7) ELISA kit

E01F0338-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat F box/WD repeat containing protein 7(FBXW7) ELISA kit

E06F0338-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat F box/WD repeat containing protein 7(FBXW7) ELISA kit

E06F0338-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat F box/WD repeat containing protein 7(FBXW7) ELISA kit

E06F0338-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Monkey F box/WD repeat containing protein 7(FBXW7) ELISA kit

E09F0338-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey F box/WD repeat containing protein 7(FBXW7) ELISA kit

E09F0338-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey F box/WD repeat containing protein 7(FBXW7) ELISA kit

E09F0338-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Data coming from 4 pollen monitoring stations in the Berlin and Brandenburg space in Germany and for three years (2014-2016) have been used to analyze the correlation of season definitions, birch and grass pollen counts and complete nasal symptom and mediation scores as reported by sufferers in “Patients Hay fever Diaries” (PHDs). After the identification of pollen durations on the foundation of the EACCI standards, a statistical evaluation was employed, adopted by an in depth graphical investigation.
The evaluation revealed that the definitions of pollen season in addition to peak pollen interval begin and finish as proposed by the EAACI are correlated to symptom hundreds for grass and birch pollen-induced allergic rhinitis reported by sufferers in PHDs.
Based on our evaluation, the validity of the EAACI definitions on pollen season is confirmed. Their use is advisable in future medical trials on AIT in addition to in each day routine for optimum affected person care.


Antigens are defined as substances capable of stimulating the production of antibodies, with which they react specifically. This definition is incomplete since it is well known that antigens can induce cell-mediated immune responses. So antigens are all molecules introduced into the body that can induce an immune response; that is to say the induction of the production of specific immune effectors (humoral or cellular) and to react with these.

antigen is a category of molecules (a molecular species) defined by its antigenic specificity. And, it defines antigenic specificity as the property of a given antigen to combine with a given (usually heterogeneous) population of antibodies. A given antigen can combine with several different or identical antibodies.


According to origin

– Xeno-antigen XENO ANTIGENS: these are the antigens present in all individuals of one or more species distinct from that to which the immunized subject belongs.
– Allo antigens (Iso antigens): these are antigens found in a group of individuals of the same species and can induce an immune response in individuals who do not have them.
– Auto antigens: these are the antigens of an individual that can induce an anti-self immune response.

Depending on whether the production of antibodies depends on T cells or not

– Thymo-dependent antigens: are those against which the production of antibodies requires the help of T lymphocytes. This category is mainly represented by proteins.
– Thymo independent antigens: are those against which the production of antibodies does not require the help of T lymphocytes; such as polysaccharides and lipopolysacharides which are characterized by the presence of repetitive epitopes.

According to the chemical nature

 Protein antigens: these are the most immunogenic antigens. There are several types:
– Natural proteins: these are the main constituents of living things. They are encoded by corresponding genes.
– Artificial proteins: these are proteins whose natural core is on which side sequences are grafted.
– Synthetic proteins.

 Polysaccharide antigens: the immunogenic power of these antigens is weak. The simple polysaccharides have repetitive antigenic determinants which can activate B lymphocytes without resorting to T lymphocytes. The antigenic determinants of these antigens are sequential and nonconformational determinants, of approximately 6 sugars.

 Lipid antigens: lipids are not immunogenic. however, after their association with proteins, they can induce an immune response. They play the role of haptens. In certain diseases we find anti phospholipid antibodies.

 Nucleic acids: the immunogenicity of these substances is controversial when all attempts at immunization fail. However, immunization with nucleic acids associated with proteins induces the production of specific antibodies.

According to physical properties (solubility)

 Soluble antigens: constitute the majority of antigens in nature (proteins, polysaccharides, etc.)
 Particulate antigens: correspond to all particles, living or inert, which can induce an immune response (bacteria, virus, cell, parasite, etc.)


  1. vaccination
  2. serotherapy
  3. in vitro diagnosis
  4. skin tests
  5. desensitization


Our body has a defense system (immune system) ensuring its integrity.
It defends it against exogenous aggressions (microorganisms) and monitors pathological cell proliferation. To accomplish this task, it has natural (innate, non-specific) and other adaptive (acquired or specific) control mechanisms. The latter are provided by effectors which recognize antigens in a specific way.

What are immunoglobulines?

Immunoglobulins are serum glycoproteins from mammalian interstitial fluid that are produced by B cells (membrane immunoglobulin) or by plasma cells (soluble immunoglobulin). In general, it is produced following specific antigenic stimulation. Immunoglobulins produced after antigen stimulation or those having corresponding antigens are called ANTIBODIES.


In mammals, there are five classes of immunoglobulins (IgG, IgM, IgA, IgE and IgD) which differ in their Phi, the half-life, the number of constant domains and the role of the constant parts. The classes and subclasses are terminated by the types of heavy chains; each of these chains is encoded by a different gene.

1/ Immunoglobulin G (IgG)

it is a glycoprotein made up of two heavy chains (γ) and two light chains (κ or λ). It represents 70 to 75% of total immunoglobulins with a concentration of 10 to 18 g / l. She
includes four subclasses: IgG1, IgG2, IgG3 and IgG4 and which represent 66%, 23%, 7% and 4% of IgG respectively. The difference between them lies in the hinge region and in the number of disulfide bridges.
Half of these immunoglobulins are 21 days, except for IgG3 which is 7 days. Their sedimentation constant is 7 S and with a PM of 146 Kd. IgG (1,2,3) fix the complement. Only IgG1 and IgG3 which can cross the placenta. The γ chain consists of 3 constant domains and a variable. But all light chains are only formed from two domains, a constant and a variable.

2/ Immunoglobulin A (IgA)

it is a glycoprotein in two forms, a monomeric form consisting of two heavy chains (α) and two light chains (κ or λ) and represents 80% of serum IgA. The second form is predominant in secretions (milk, saliva …). It is dimeric of 385 Kd and 11 S. it contains the chain J of 15 Kd plus a secretory component of 70 Kd. IgA groups two subclasses:
IgA1 which is found, above all, in serum form and IgA2 which is found, above all, in secretory form. The concentration of serum IgA is 1 to 4.5 g / 1. They do not fix the complement and do not cross the placenta. The α chain consists of 3 constant domains and a variable.

3/ Immunoglobuline M (IgM)

it is a glycoprotein of 900 Kd and 19 S. Usually, it is pentameric and made up of 10 heavy chains (μ) and 10 light chains (κ or λ) identical. It represents 10% of serum immunoglobulins. The subunits are linked together by disulfide bridges and the chain J (junction). The μ chain contains four constant domains and one variable. The membrane IgM is monomeric containing an additional hydrophobic sequence which allows it to anchor to the cytoplasmic membrane. This molecule constitutes the specific receptor for the antigen on the B lymphocyte (BCR). It is associated with two molecules Igα (CD79a) and Igβ (C79b) which are responsible for signal transduction after antigenic stimulation.

4/ Immunoglobulin D

it is a glycoprotein consisting of two heavy chains (δ) and two light chains q (κ or λ) identical. It represents 10% of serum Ig. It exists in two forms; the serum form which is soluble and the membrane form which constitutes, with the membrane IgM, the BCRs of mature B lymphocytes. It is the most sensitive to proteolysis.
The heavy chains δ only bind to each other by a disulfide bridge. It is 184 kd, 7 S and a half-life of 3 days. The serum concentration is 0.05 to 0.4 g / l. the heavy chain has three constant domains and one variable.

5/ Immunoglobulins E

it is 190 Kd and 8S glycoprotein with a half-life of 3 days. It consists of two heavy chains (ε) and two light chains (κ or λ). Its serum concentration is 0.003 g / l. Most IgE are found to be fixed on basophils and mast cells by receptors specific to the constant part (RFCεI). It does not fix the complement and does not cross the placenta. It is a thermolabile Ig.


an immunoglobulin can induce an adaptive immune response (production of antibodies). So it has the properties of an antigen. The antibodies produced are directed against the various antigenic determinants located on the constant part or the variable part. There are three groups of antigenic determinants of light chains or heavy chains defining the isotype, allotype and idiotype.

1- Isotype: it is the properties of antigenic determinants which define the classes and subclasses of immunoglobulins of the same species. It is carried by the constant part.

2 – Allotype: it is the properties of antigenic determinants which differentiate different individuals within the same species. It is carried by the constant part.

3 – Idiotype: it is the properties of antigenic determinants which differentiate immunoglobulins of the same isotype and of same allotype in an individual. It is carried by the variable part.


An immunoglobulin molecule consists of a variable part, represented by the Fab fragment which constitutes the site of attachment of the antigen to the antibody; the latter is called the PARATOPE. So the variable part is responsible for the recognition of the antigen and the reaction with it. The constant party represented by the FC plays several roles:
(1) Activation of the complement (IgG1, IgG2, lgG3).
(2) binding to receptors carried by cells derived from the hematopoietic line (cytophilia or cytotropy).
IgG have three receptors: RFCγI or CD 64, RFCγII or CD 32 and RFCγIII or CD 16. They mainly fix IgG l and IgG 3. They are expressed by monocytes, macrophages, polynuclear, NK and CTL. IgEs have two receptors: RFCε I which is expressed by mast cells and basophils and RFCεII or CD23 which is expressed by the majority of blood cells (monocyte; polynuclear, lymphocytes, platelets …).
(3) the catabolism of immunoglobulins whose speed is regulated by Fc and more precisely by CH2.
(4) certain isotypes of immunoglobulins have the property of crossing cells (trans cytosis). IgA is secreted in exocrine secretions and IgG is secreted in the interstitial fluid.


The first contact of the antigen With the organism activates the immune cells (T and B lymphocytes) and induces a primary immune response which is characterized by:

  • The latency phase lasts several days
  • The Ig level is slightly increased and then declines rapidly
  • The isotype is IgM

The second contact induces a secondary immune response which is characterized by:

  • The latency phase is very short
  • the Ig level is very high
  • the isotype is IgG especially with also IgA and IgM


-Search for soluble or particulate antigens (invitro)
-Immuno-scintigraphy (invivo)