AllergoOncology: Microbiota in allergy and cancer-A European Academy for Allergy and Clinical Immunology position paper.

The microbiota can play necessary roles in the event of human immunity and the institution of immune homeostasis. Lifestyle elements together with food regimen, hygiene, and publicity to viruses or micro organism, and medical interventions with antibiotics or anti-ulcer medicines, regulate phylogenetic variability and the standard of cross speak between innate and adaptive immune cells through mucosal and pores and skin epithelia.

More just lately, microbiota and their composition have been linked to protecting results for well being. Imbalance, nonetheless, has been linked to immune-related ailments comparable to allergy and most cancers, characterised by impaired, or exaggerated immune tolerance, respectively.

In this AllergoOncology position paper, we give attention to the growing proof defining the microbiota composition as a key determinant of immunity and immune tolerance, linked to the chance for the event of allergic and malignant ailments. We focus on novel insights into the function of microbiota in illness and affected person responses to remedies in most cancers and in allergy.

These might spotlight alternatives to enhance affected person outcomes with medical interventions supported by way of a restored microbiome.

Non-allergic rhinitis: Position paper of the European Academy of Allergy and Clinical Immunology.

This EAACI position paper goals at offering a state-of-the-art overview on nonallergic rhinitis (NAR). A big variety of sufferers affected by persistent rhinitis are outlined as nonallergic noninfectious rhinitis (NANIR) sufferers, usually denominated in quick as having NAR.

NAR is outlined as a symptomatic irritation of the nasal mucosa with the presence of a minimal of two nasal signs comparable to nasal obstruction, rhinorrhea, sneezing, and/or itchy nostril, with out medical proof of endonasal an infection and with out systemic indicators of sensitization to inhalant allergens. Symptoms of NAR might have a variety of severity and be both constantly current and/or induced by publicity to unspecific triggers, additionally known as nasal hyperresponsiveness (NHR).

FBXW5 Antibody
1-CSB-PA846577LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW5. Recognizes FBXW5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

FBXW5 Antibody
DF13011	Affbiotech	200ul	EUR 304
Description: FBXW5 Antibody detects endogenous levels of FBXW5.

FBXW5 siRNA
20-abx901921	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FBXW5 siRNA
20-abx916666	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FBXW5 siRNA
20-abx916667	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-FBXW5
YF-PA19299	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to FBXW5

FBXW5 Polyclonal Antibody
31706-100ul	SAB	100ul	EUR 252

FBXW5 Polyclonal Antibody
31706-50ul	SAB	50ul	EUR 187

FBXW5 Blocking Peptide
DF13011-BP	Affbiotech	1mg	EUR 195

FBXW5 cloning plasmid
CSB-CL846577HU1-10ug	Cusabio	10ug	EUR 586
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 1701 Sequence: atggacgagggcggcacgcccctgctccccgacagcctggtctaccagatcttcctgagcctgggcccggccgacgtgctggccgccgggctggtgtgccgccaatggcaggccgtgtcgcgggacgagttcctgtggagggagcagttctaccgctactaccaggtggcccgcg Show more
Description: A cloning plasmid for the FBXW5 gene.

FBXW5 cloning plasmid
CSB-CL846577HU2-10ug	Cusabio	10ug	EUR 244
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 480 Sequence: atgggcctgtcgcccgacaacaggtacctgtacgtgaacagccgcgcctggcccaacggtgcggtggtggccgaccccatgcagccgccaccaatcgcggaggagattgacctgctggtgttcgacctcaagaccatgcgggaggtgaggcgggctctgcgtgcgcaccgcgccta Show more
Description: A cloning plasmid for the FBXW5 gene.

FBXW5 Rabbit pAb
A9345-100ul	Abclonal	100 ul	EUR 308

FBXW5 Rabbit pAb
A9345-200ul	Abclonal	200 ul	EUR 459

FBXW5 Rabbit pAb
A9345-20ul	Abclonal	20 ul	EUR 183

FBXW5 Rabbit pAb
A9345-50ul	Abclonal	50 ul	EUR 223

anti- FBXW5 antibody
FNab03056	FN Test	100µg	EUR 505.25
Immunogen: F-box and WD repeat domain containing 5 Uniprot ID: Q969U6 Gene ID: 54461 Research Area: Metabolism
Description: Antibody raised against FBXW5

Anti-FBXW5 antibody
PAab03056	Lifescience Market	100 ug	EUR 355

Anti-FBXW5 antibody
STJ111668	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene contains WD-40 domains, in addition to an F-box motif, so it belongs to the Fbw class. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene, however, they were found to be nonsense-mediated mRNA decay (NMD) candidates, hence not represented.

FBXW5 Antibody, HRP conjugated
1-CSB-PA846577LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW5. Recognizes FBXW5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FBXW5 Antibody, FITC conjugated
1-CSB-PA846577LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW5. Recognizes FBXW5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FBXW5 Antibody, Biotin conjugated
1-CSB-PA846577LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW5. Recognizes FBXW5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

FBXW5 ELISA KIT\|Human
EF009597	Lifescience Market	96 Tests	EUR 689

Rat FBXW5 shRNA Plasmid
20-abx990317	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse FBXW5 shRNA Plasmid
20-abx974031	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FBXW5 Polyclonal Conjugated Antibody
C31706	SAB	100ul	EUR 397

Human FBXW5 shRNA Plasmid
20-abx960068	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FBXW5 Recombinant Protein (Human)
RP011965	ABM	100 ug	Ask for price

FBXW5 Recombinant Protein (Human)
RP011968	ABM	100 ug	Ask for price

FBXW5 Recombinant Protein (Rat)
RP201080	ABM	100 ug	Ask for price

FBXW5 Recombinant Protein (Mouse)
RP134156	ABM	100 ug	Ask for price

Fbxw5 ORF Vector (Rat) (pORF)
ORF067028	ABM	1.0 ug DNA	EUR 506

FBXW5 ORF Vector (Human) (pORF)
ORF003989	ABM	1.0 ug DNA	EUR 95

FBXW5 ORF Vector (Human) (pORF)
ORF003990	ABM	1.0 ug DNA	EUR 95

Fbxw5 ORF Vector (Mouse) (pORF)
ORF044720	ABM	1.0 ug DNA	EUR 506

Fbxw5 sgRNA CRISPR Lentivector set (Rat)
K7164801	ABM	3 x 1.0 ug	EUR 339

FBXW5 sgRNA CRISPR Lentivector set (Human)
K0767501	ABM	3 x 1.0 ug	EUR 339

Fbxw5 sgRNA CRISPR Lentivector set (Mouse)
K4573401	ABM	3 x 1.0 ug	EUR 339

Fbxw5 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7164802	ABM	1.0 ug DNA	EUR 154

Fbxw5 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7164803	ABM	1.0 ug DNA	EUR 154

Fbxw5 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7164804	ABM	1.0 ug DNA	EUR 154

FBXW5 sgRNA CRISPR Lentivector (Human) (Target 1)
K0767502	ABM	1.0 ug DNA	EUR 154

FBXW5 sgRNA CRISPR Lentivector (Human) (Target 2)
K0767503	ABM	1.0 ug DNA	EUR 154

FBXW5 sgRNA CRISPR Lentivector (Human) (Target 3)
K0767504	ABM	1.0 ug DNA	EUR 154

Fbxw5 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4573402	ABM	1.0 ug DNA	EUR 154

Fbxw5 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4573403	ABM	1.0 ug DNA	EUR 154

Fbxw5 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4573404	ABM	1.0 ug DNA	EUR 154

FBXW5 Protein Vector (Mouse) (pPB-C-His)
PV178878	ABM	500 ng	EUR 603

FBXW5 Protein Vector (Mouse) (pPB-N-His)
PV178879	ABM	500 ng	EUR 603

FBXW5 Protein Vector (Mouse) (pPM-C-HA)
PV178880	ABM	500 ng	EUR 603

FBXW5 Protein Vector (Mouse) (pPM-C-His)
PV178881	ABM	500 ng	EUR 603

FBXW5 Protein Vector (Rat) (pPB-C-His)
PV268110	ABM	500 ng	EUR 603

FBXW5 Protein Vector (Rat) (pPB-N-His)
PV268111	ABM	500 ng	EUR 603

FBXW5 Protein Vector (Rat) (pPM-C-HA)
PV268112	ABM	500 ng	EUR 603

FBXW5 Protein Vector (Rat) (pPM-C-His)
PV268113	ABM	500 ng	EUR 603

FBXW5 Protein Vector (Human) (pPB-C-His)
PV015953	ABM	500 ng	EUR 329

FBXW5 Protein Vector (Human) (pPB-N-His)
PV015954	ABM	500 ng	EUR 329

FBXW5 Protein Vector (Human) (pPM-C-HA)
PV015955	ABM	500 ng	EUR 329

FBXW5 Protein Vector (Human) (pPM-C-His)
PV015956	ABM	500 ng	EUR 329

FBXW5 Protein Vector (Human) (pPB-C-His)
PV015957	ABM	500 ng	EUR 329

FBXW5 Protein Vector (Human) (pPB-N-His)
PV015958	ABM	500 ng	EUR 329

FBXW5 Protein Vector (Human) (pPM-C-HA)
PV015959	ABM	500 ng	EUR 329

FBXW5 Protein Vector (Human) (pPM-C-His)
PV015960	ABM	500 ng	EUR 329

Fbxw5 3'UTR GFP Stable Cell Line
TU156465	ABM	1.0 ml	Ask for price

Fbxw5 3'UTR Luciferase Stable Cell Line
TU106465	ABM	1.0 ml	Ask for price

Fbxw5 3'UTR Luciferase Stable Cell Line
TU204532	ABM	1.0 ml	Ask for price

Fbxw5 3'UTR GFP Stable Cell Line
TU254532	ABM	1.0 ml	Ask for price

FBXW5 3'UTR GFP Stable Cell Line
TU057812	ABM	1.0 ml	EUR 1394

FBXW5 3'UTR Luciferase Stable Cell Line
TU007812	ABM	1.0 ml	EUR 1394

FBXW5 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV710091	ABM	1.0 ug DNA	EUR 316

FBXW5 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV710095	ABM	1.0 ug DNA	EUR 316

FBXW5 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV710096	ABM	1.0 ug DNA	EUR 316

FBXW5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV660133	ABM	1.0 ug DNA	EUR 682

FBXW5 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV660137	ABM	1.0 ug DNA	EUR 682

FBXW5 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV660138	ABM	1.0 ug DNA	EUR 682

F-Box And WD Repeat Domain Containing 5 (FBXW5) Antibody
20-abx123928	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 5 (FBXW5) Antibody
abx031051-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 5 (FBXW5) Antibody
abx031051-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 5 (FBXW5) Antibody
20-abx313725	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 5 (FBXW5) Antibody
abx233056-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Fbxw5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7164805	ABM	3 x 1.0 ug	EUR 376

FBXW5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0767505	ABM	3 x 1.0 ug	EUR 376

Fbxw5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4573405	ABM	3 x 1.0 ug	EUR 376

Rat F box/WD repeat containing protein 5(FBXW5) ELISA kit
E02F0337-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat F box/WD repeat containing protein 5(FBXW5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat F box/WD repeat containing protein 5(FBXW5) ELISA kit
E02F0337-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat F box/WD repeat containing protein 5(FBXW5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat F box/WD repeat containing protein 5(FBXW5) ELISA kit
E02F0337-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat F box/WD repeat containing protein 5(FBXW5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F box/WD repeat containing protein 5(FBXW5) ELISA kit
E03F0337-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse F box/WD repeat containing protein 5(FBXW5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F box/WD repeat containing protein 5(FBXW5) ELISA kit
E03F0337-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse F box/WD repeat containing protein 5(FBXW5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F box/WD repeat containing protein 5(FBXW5) ELISA kit
E03F0337-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse F box/WD repeat containing protein 5(FBXW5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit F box/WD repeat containing protein 5(FBXW5) ELISA kit
E04F0337-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit F box/WD repeat containing protein 5(FBXW5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit F box/WD repeat containing protein 5(FBXW5) ELISA kit
E04F0337-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit F box/WD repeat containing protein 5(FBXW5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit F box/WD repeat containing protein 5(FBXW5) ELISA kit
E04F0337-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit F box/WD repeat containing protein 5(FBXW5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human F box/WD repeat containing protein 5(FBXW5) ELISA kit
E01F0337-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human F box/WD repeat containing protein 5(FBXW5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human F box/WD repeat containing protein 5(FBXW5) ELISA kit
E01F0337-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human F box/WD repeat containing protein 5(FBXW5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human F box/WD repeat containing protein 5(FBXW5) ELISA kit
E01F0337-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human F box/WD repeat containing protein 5(FBXW5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat F box/WD repeat containing protein 5(FBXW5) ELISA kit
E06F0337-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat F box/WD repeat containing protein 5(FBXW5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat F box/WD repeat containing protein 5(FBXW5) ELISA kit
E06F0337-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat F box/WD repeat containing protein 5(FBXW5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat F box/WD repeat containing protein 5(FBXW5) ELISA kit
E06F0337-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat F box/WD repeat containing protein 5(FBXW5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey F box/WD repeat containing protein 5(FBXW5) ELISA kit
E09F0337-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey F box/WD repeat containing protein 5(FBXW5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey F box/WD repeat containing protein 5(FBXW5) ELISA kit
E09F0337-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey F box/WD repeat containing protein 5(FBXW5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey F box/WD repeat containing protein 5(FBXW5) ELISA kit
E09F0337-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey F box/WD repeat containing protein 5(FBXW5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog F box/WD repeat containing protein 5(FBXW5) ELISA kit
E08F0337-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine F box/WD repeat containing protein 5(FBXW5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog F box/WD repeat containing protein 5(FBXW5) ELISA kit
E08F0337-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine F box/WD repeat containing protein 5(FBXW5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog F box/WD repeat containing protein 5(FBXW5) ELISA kit
E08F0337-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine F box/WD repeat containing protein 5(FBXW5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human F- box/WD repeat- containing protein 5, FBXW5 ELISA KIT
ELI-12883h	Lifescience Market	96 Tests	EUR 824

Pig F box/WD repeat containing protein 5(FBXW5) ELISA kit
E07F0337-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine F box/WD repeat containing protein 5(FBXW5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig F box/WD repeat containing protein 5(FBXW5) ELISA kit
E07F0337-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine F box/WD repeat containing protein 5(FBXW5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig F box/WD repeat containing protein 5(FBXW5) ELISA kit
E07F0337-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine F box/WD repeat containing protein 5(FBXW5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

F-Box And WD Repeat Domain Containing 5 (FBXW5) Antibody (HRP)
20-abx313726	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 5 (FBXW5) Antibody (FITC)
20-abx313727	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 5 (FBXW5) Antibody (Biotin)
20-abx313728	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

FBXW5 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV710092	ABM	1.0 ug DNA	EUR 316

FBXW5 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV710093	ABM	1.0 ug DNA	EUR 374

FBXW5 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV710094	ABM	1.0 ug DNA	EUR 374

Mouse F- box/WD repeat- containing protein 5, Fbxw5 ELISA KIT
ELI-47411m	Lifescience Market	96 Tests	EUR 865

FBXW5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV660134	ABM	1.0 ug DNA	EUR 682

FBXW5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV660135	ABM	1.0 ug DNA	EUR 740

FBXW5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV660136	ABM	1.0 ug DNA	EUR 740

Fbxw5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7164806	ABM	1.0 ug DNA	EUR 167

Fbxw5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7164807	ABM	1.0 ug DNA	EUR 167

Fbxw5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7164808	ABM	1.0 ug DNA	EUR 167

FBXW5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0767506	ABM	1.0 ug DNA	EUR 167

FBXW5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0767507	ABM	1.0 ug DNA	EUR 167

FBXW5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0767508	ABM	1.0 ug DNA	EUR 167

Fbxw5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4573406	ABM	1.0 ug DNA	EUR 167

Fbxw5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4573407	ABM	1.0 ug DNA	EUR 167

Fbxw5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4573408	ABM	1.0 ug DNA	EUR 167

Guinea pig F box/WD repeat containing protein 5(FBXW5) ELISA kit
E05F0337-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig F box/WD repeat containing protein 5(FBXW5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig F box/WD repeat containing protein 5(FBXW5) ELISA kit
E05F0337-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig F box/WD repeat containing protein 5(FBXW5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig F box/WD repeat containing protein 5(FBXW5) ELISA kit
E05F0337-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig F box/WD repeat containing protein 5(FBXW5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human F-Box and WD Repeat Domain Containing 5 (FBXW5) ELISA Kit
abx387333-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

NHR represents a medical characteristic of each AR and NAR sufferers. NAR includes totally different subgroups: drug-induced rhinitis, (nonallergic) occupational rhinitis, hormonal rhinitis (together with being pregnant rhinitis), gustatory rhinitis, senile rhinitis, and idiopathic rhinitis (IR).

NAR must be distinguished from these rhinitis sufferers with an allergic response confined to the nasal mucosa, additionally known as “entopy” or native allergic rhinitis (LAR). We right here present an outline of the present consensus on phenotypes of NAR, suggestions for analysis, a remedy algorithm, and defining the unmet wants in this uncared for space of analysis.

Non-allergic rhinitis: Position paper of the European Academy of Allergy and Clinical Immunology.

FBXW5 Antibody

FBXW5 Antibody

FBXW5 siRNA

FBXW5 siRNA

FBXW5 siRNA

anti-FBXW5

FBXW5 Polyclonal Antibody

FBXW5 Polyclonal Antibody

FBXW5 Blocking Peptide

FBXW5 cloning plasmid

FBXW5 cloning plasmid

FBXW5 Rabbit pAb

FBXW5 Rabbit pAb

FBXW5 Rabbit pAb

FBXW5 Rabbit pAb

anti- FBXW5 antibody

Anti-FBXW5 antibody

Anti-FBXW5 antibody

FBXW5 Antibody, HRP conjugated

FBXW5 Antibody, FITC conjugated

FBXW5 Antibody, Biotin conjugated

FBXW5 ELISA KIT|Human

Rat FBXW5 shRNA Plasmid

Mouse FBXW5 shRNA Plasmid

FBXW5 Polyclonal Conjugated Antibody

Human FBXW5 shRNA Plasmid

FBXW5 Recombinant Protein (Human)

FBXW5 Recombinant Protein (Human)

FBXW5 Recombinant Protein (Rat)

FBXW5 Recombinant Protein (Mouse)

Fbxw5 ORF Vector (Rat) (pORF)

FBXW5 ORF Vector (Human) (pORF)

FBXW5 ORF Vector (Human) (pORF)

Fbxw5 ORF Vector (Mouse) (pORF)

Fbxw5 sgRNA CRISPR Lentivector set (Rat)

FBXW5 sgRNA CRISPR Lentivector set (Human)

Fbxw5 sgRNA CRISPR Lentivector set (Mouse)

Fbxw5 sgRNA CRISPR Lentivector (Rat) (Target 1)

Fbxw5 sgRNA CRISPR Lentivector (Rat) (Target 2)

Fbxw5 sgRNA CRISPR Lentivector (Rat) (Target 3)

FBXW5 sgRNA CRISPR Lentivector (Human) (Target 1)

FBXW5 sgRNA CRISPR Lentivector (Human) (Target 2)

FBXW5 sgRNA CRISPR Lentivector (Human) (Target 3)

Fbxw5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

Fbxw5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

Fbxw5 sgRNA CRISPR Lentivector (Mouse) (Target 3)

FBXW5 Protein Vector (Mouse) (pPB-C-His)

FBXW5 Protein Vector (Mouse) (pPB-N-His)

FBXW5 Protein Vector (Mouse) (pPM-C-HA)

FBXW5 Protein Vector (Mouse) (pPM-C-His)

FBXW5 Protein Vector (Rat) (pPB-C-His)

FBXW5 Protein Vector (Rat) (pPB-N-His)

FBXW5 Protein Vector (Rat) (pPM-C-HA)

FBXW5 Protein Vector (Rat) (pPM-C-His)

FBXW5 Protein Vector (Human) (pPB-C-His)

FBXW5 Protein Vector (Human) (pPB-N-His)

FBXW5 Protein Vector (Human) (pPM-C-HA)

FBXW5 Protein Vector (Human) (pPM-C-His)

FBXW5 Protein Vector (Human) (pPB-C-His)

FBXW5 Protein Vector (Human) (pPB-N-His)

FBXW5 Protein Vector (Human) (pPM-C-HA)

FBXW5 Protein Vector (Human) (pPM-C-His)

Fbxw5 3'UTR GFP Stable Cell Line

Fbxw5 3'UTR Luciferase Stable Cell Line

Fbxw5 3'UTR Luciferase Stable Cell Line

Fbxw5 3'UTR GFP Stable Cell Line

FBXW5 3'UTR GFP Stable Cell Line

FBXW5 3'UTR Luciferase Stable Cell Line

FBXW5 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

FBXW5 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

FBXW5 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

FBXW5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

FBXW5 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

FBXW5 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

F-Box And WD Repeat Domain Containing 5 (FBXW5) Antibody

F-Box And WD Repeat Domain Containing 5 (FBXW5) Antibody

F-Box And WD Repeat Domain Containing 5 (FBXW5) Antibody

F-Box And WD Repeat Domain Containing 5 (FBXW5) Antibody

F-Box And WD Repeat Domain Containing 5 (FBXW5) Antibody