Quality standards in respiratory real-life effectiveness research: the REal Life EVidence AssessmeNt Tool (RELEVANT): report from the Respiratory Effectiveness Group-European Academy of Allergy and Clinical Immunology Task Force.

A Task Force was commissioned collectively by the European Academy of Allergy and Clinical Immunology (EAACI) and the Respiratory Effectiveness Group (REG) to develop a high quality evaluation device for real-life observational analysis to establish high-quality real-life bronchial asthma research that might be thought-about inside future guideline growth.The ensuing REal Life EVidence AssessmeNt Tool (RELEVANT) was achieved by way of an intensive evaluation of present initiatives in this space.

The first model was piloted amongst 9 raters throughout 6 articles; the revised, interim, model underwent in depth testing by 22 reviewers from the EAACI membership and REG collaborator group, resulting in additional revisions and device finalisation. RELEVANT was validated by way of an evaluation of real-life effectiveness research recognized by way of systematic evaluate of Medline and Embase databases and regarding subjects for which real-life research might provide priceless proof complementary to that from randomised managed trials.

The subjects have been chosen by way of a vote amongst Task Force members and associated to the affect of adherence, smoking, inhaler machine and particle measurement on bronchial asthma remedy effectiveness.Although highlighting a basic lack of high-quality real-life effectiveness observational analysis on these clinically vital subjects, the evaluation offered insights into how recognized observational research may inform bronchial asthma pointers builders and clinicians.

Overall, RELEVANT appeared dependable and straightforward to make use of by professional reviewers.Using such high quality appraisal instruments is obligatory to evaluate whether or not particular observational real-life effectiveness research can be utilized to tell guideline growth and/or decision-making in medical observe.

 Quality standards in respiratory real-life effectiveness research: the REal Life EVidence AssessmeNt Tool (RELEVANT): report from the Respiratory Effectiveness Group-European Academy of Allergy and Clinical Immunology Task Force.
Quality standards in respiratory real-life effectiveness analysis: the REal Life EVidence AssessmeNt Tool (RELEVANT): report from the Respiratory Effectiveness Group-European Academy of Allergy and Clinical Immunology Task Force.

New European Academy of Allergy and Clinical Immunology definition on pollen season mirrors symptom load for grass and birch pollen-induced allergic rhinitis.

BACKGROUND
The use of allergen immunotherapy (AIT) for allergic rhinitis and its medical efficacy in medical trials will depend on the efficient dedication of pollen allergen publicity time durations. We consider pollen information from Germany to look at the new definitions on pollen season and peak pollen interval begin and finish as proposed by the European Academy of Allergy and Clinical Immunology (EAACI) in a just lately printed Position Paper. The goal was to reveal the potential of these definitions to reflect symptom hundreds for grass and birch pollen-induced allergic rhinitis primarily based on real-life information.

FBXW7 Antibody

1-CSB-PA623964
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FBXW7. Recognizes FBXW7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

FBXW7 Antibody

1-CSB-PA822163LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW7. Recognizes FBXW7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

FBXW7 Antibody

DF12400 200ul
EUR 304.00
Description: FBXW7 antibody detects endogenous levels of FBXW7.

FBXW7 Antibody

1-CSB-PA251991
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FBXW7. Recognizes FBXW7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

FBXW7 antibody

70R-6541 50 ug
EUR 467.00
Description: Rabbit polyclonal FBXW7 antibody raised against the C terminal of FBXW7

FBXW7 siRNA

20-abx916668
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

FBXW7 siRNA

20-abx916669
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

anti-FBXW7

YF-PA19671 50 ug
EUR 363.00
Description: Mouse polyclonal to FBXW7

anti-FBXW7

YF-PA19672 100 ug
EUR 403.00
Description: Rabbit polyclonal to FBXW7

anti-FBXW7

YF-PA26323 50 ul
EUR 334.00
Description: Mouse polyclonal to FBXW7

FBXW7 Blocking Peptide

33R-5108 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FBXW7 antibody, catalog no. 70R-6541

FBXW7 Blocking Peptide

DF12400-BP 1mg
EUR 195.00

FBXW7 cloning plasmid

CSB-CL822163HU-10ug 10ug
EUR 705.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2124
  • Sequence: atgaatcaggaactgctctctgtgggcagcaaaagacgacgaactggaggctctctgagaggtaacccttcctcaagccaggtagatgaagaacagatgaatcgtgtggtagaggaggaacagcaacagcaactcagacaacaagaggaggagcacactgcaaggaatggtgaag
  • Show more
Description: A cloning plasmid for the FBXW7 gene.

FBXW7 Rabbit pAb

A5872-100ul 100 ul
EUR 308.00

FBXW7 Rabbit pAb

A5872-200ul 200 ul
EUR 459.00

FBXW7 Rabbit pAb

A5872-20ul 20 ul
EUR 183.00

FBXW7 Rabbit pAb

A5872-50ul 50 ul
EUR 223.00

anti- FBXW7 antibody

FNab03057 100µg
EUR 585.00
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: F-box and WD repeat domain containing 7
  • Uniprot ID: Q969H0
  • Gene ID: 55294
  • Research Area: Immunology, Cardiovascular, Metabolism
Description: Antibody raised against FBXW7

Anti-FBXW7 antibody

PAab03057 100 ug
EUR 412.00

pDONR223-FBXW7 Plasmid

PVTB00367 2 ug
EUR 356.00

Anti-FBXW7 antibody

STJ29923 100 µl
EUR 277.00
Description: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene was previously referred to as FBX30, and belongs to the Fbws class; in addition to an F-box, this protein contains 7 tandem WD40 repeats. This protein binds directly to cyclin E and probably targets cyclin E for ubiquitin-mediated degradation. Mutations in this gene are detected in ovarian and breast cancer cell lines, implicating the gene's potential role in the pathogenesis of human cancers. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-FBXW7 (3D1)

YF-MA11557 100 ug
EUR 363.00
Description: Mouse monoclonal to FBXW7

Anti-Fbxw7 (1C11)

YF-MA18764 100 ug
EUR 363.00
Description: Mouse monoclonal to Fbxw7

FBXW7 Antibody, HRP conjugated

1-CSB-PA822163LB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW7. Recognizes FBXW7 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FBXW7 Antibody, FITC conjugated

1-CSB-PA822163LC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW7. Recognizes FBXW7 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FBXW7 Antibody, Biotin conjugated

1-CSB-PA822163LD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW7. Recognizes FBXW7 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

FBXW7 ELISA KIT|Human

EF009598 96 Tests
EUR 689.00

Mouse FBXW7 shRNA Plasmid

20-abx974100
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human FBXW7 shRNA Plasmid

20-abx960632
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

pECMV- 3*Flag- FBXW7

PVT10356 2 ug
EUR 301.00

FBXW7 Recombinant Protein (Human)

RP039052 100 ug Ask for price

FBXW7 Recombinant Protein (Mouse)

RP134159 100 ug Ask for price

FBXW7 Recombinant Protein (Mouse)

RP134162 100 ug Ask for price

FBXW7 Recombinant Protein (Mouse)

RP134165 100 ug Ask for price

Polyclonal Fbxw7 antibody - middle region

APR00709G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Fbxw7 - middle region. This antibody is tested and proven to work in the following applications:

FBXW7 ORF Vector (Human) (pORF)

ORF013018 1.0 ug DNA
EUR 95.00

Fbxw7 ORF Vector (Mouse) (pORF)

ORF044721 1.0 ug DNA
EUR 506.00

Fbxw7 ORF Vector (Mouse) (pORF)

ORF044722 1.0 ug DNA
EUR 506.00

Fbxw7 ORF Vector (Mouse) (pORF)

ORF044723 1.0 ug DNA
EUR 506.00

Polyclonal FBXW7 / FBW7 Antibody (N-Terminus)

APR02668G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FBXW7 / FBW7 (N-Terminus). This antibody is tested and proven to work in the following applications:

FBXW7 sgRNA CRISPR Lentivector set (Human)

K0767601 3 x 1.0 ug
EUR 339.00

Fbxw7 sgRNA CRISPR Lentivector set (Mouse)

K4531701 3 x 1.0 ug
EUR 339.00

Monoclonal FBXW7 Antibody (monoclonal) (M02), Clone: 3D1

AMM03534G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human FBXW7 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 3D1. This antibody is applicable in WB and IHC, E

FBXW7 sgRNA CRISPR Lentivector (Human) (Target 1)

K0767602 1.0 ug DNA
EUR 154.00

FBXW7 sgRNA CRISPR Lentivector (Human) (Target 2)

K0767603 1.0 ug DNA
EUR 154.00

FBXW7 sgRNA CRISPR Lentivector (Human) (Target 3)

K0767604 1.0 ug DNA
EUR 154.00

Fbxw7 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4531702 1.0 ug DNA
EUR 154.00

Fbxw7 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4531703 1.0 ug DNA
EUR 154.00

Fbxw7 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4531704 1.0 ug DNA
EUR 154.00

FBXW7 Protein Vector (Mouse) (pPB-C-His)

PV178882 500 ng
EUR 1065.00

FBXW7 Protein Vector (Mouse) (pPB-N-His)

PV178883 500 ng
EUR 1065.00

FBXW7 Protein Vector (Mouse) (pPM-C-HA)

PV178884 500 ng
EUR 1065.00

FBXW7 Protein Vector (Mouse) (pPM-C-His)

PV178885 500 ng
EUR 1065.00

FBXW7 Protein Vector (Mouse) (pPB-C-His)

PV178886 500 ng
EUR 1065.00

FBXW7 Protein Vector (Mouse) (pPB-N-His)

PV178887 500 ng
EUR 1065.00

FBXW7 Protein Vector (Mouse) (pPM-C-HA)

PV178888 500 ng
EUR 1065.00

FBXW7 Protein Vector (Mouse) (pPM-C-His)

PV178889 500 ng
EUR 1065.00

FBXW7 Protein Vector (Mouse) (pPB-C-His)

PV178890 500 ng
EUR 603.00

FBXW7 Protein Vector (Mouse) (pPB-N-His)

PV178891 500 ng
EUR 603.00

FBXW7 Protein Vector (Mouse) (pPM-C-HA)

PV178892 500 ng
EUR 603.00

FBXW7 Protein Vector (Mouse) (pPM-C-His)

PV178893 500 ng
EUR 603.00

FBXW7 Protein Vector (Human) (pPB-C-His)

PV052069 500 ng
EUR 481.00

FBXW7 Protein Vector (Human) (pPB-N-His)

PV052070 500 ng
EUR 481.00

FBXW7 Protein Vector (Human) (pPM-C-HA)

PV052071 500 ng
EUR 481.00

FBXW7 Protein Vector (Human) (pPM-C-His)

PV052072 500 ng
EUR 481.00

Fbxw7 3'UTR GFP Stable Cell Line

TU156466 1.0 ml Ask for price

Fbxw7 3'UTR Luciferase Stable Cell Line

TU106466 1.0 ml Ask for price

FBXW7 3'UTR GFP Stable Cell Line

TU057813 1.0 ml
EUR 1521.00

FBXW7 3'UTR Luciferase Stable Cell Line

TU007813 1.0 ml
EUR 1521.00

Human F-box/WD repeat-containing protein 7 (FBXW7)

1-CSB-CF822163HU
  • EUR 965.00
  • EUR 665.00
  • EUR 715.00
  • 0
  • 1
  • 2
  • MW: 83.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human F-box/WD repeat-containing protein 7(FBXW7) expressed in in vitro E.coli expression system

F-Box And WD Repeat Domain Containing 7 (FBXW7) Antibody

20-abx006803
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 7 (FBXW7) Antibody

20-abx124024
  • EUR 411.00
  • EUR 592.00
  • 0
  • 1
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 7 (FBXW7) Antibody

abx145824-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 7 (FBXW7) Antibody

20-abx317508
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 7 (FBXW7) Antibody

abx233057-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.

FBXW7 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0767605 3 x 1.0 ug
EUR 376.00

Fbxw7 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4531705 3 x 1.0 ug
EUR 376.00

Rat F box/WD repeat containing protein 7(FBXW7) ELISA kit

E02F0338-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat F box/WD repeat containing protein 7(FBXW7) ELISA kit

E02F0338-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat F box/WD repeat containing protein 7(FBXW7) ELISA kit

E02F0338-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F box/WD repeat containing protein 7(FBXW7) ELISA kit

E03F0338-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F box/WD repeat containing protein 7(FBXW7) ELISA kit

E03F0338-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F box/WD repeat containing protein 7(FBXW7) ELISA kit

E03F0338-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit F box/WD repeat containing protein 7(FBXW7) ELISA kit

E04F0338-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit F box/WD repeat containing protein 7(FBXW7) ELISA kit

E04F0338-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit F box/WD repeat containing protein 7(FBXW7) ELISA kit

E04F0338-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human F box/WD repeat containing protein 7(FBXW7) ELISA kit

E01F0338-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human F box/WD repeat containing protein 7(FBXW7) ELISA kit

E01F0338-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human F box/WD repeat containing protein 7(FBXW7) ELISA kit

E01F0338-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat F box/WD repeat containing protein 7(FBXW7) ELISA kit

E06F0338-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat F box/WD repeat containing protein 7(FBXW7) ELISA kit

E06F0338-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat F box/WD repeat containing protein 7(FBXW7) ELISA kit

E06F0338-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Antibody

20-abx212397
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Antibody

20-abx212888
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Antibody

20-abx128045
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Antibody

20-abx129356
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Monkey F box/WD repeat containing protein 7(FBXW7) ELISA kit

E09F0338-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey F box/WD repeat containing protein 7(FBXW7) ELISA kit

E09F0338-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey F box/WD repeat containing protein 7(FBXW7) ELISA kit

E09F0338-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog F box/WD repeat containing protein 7(FBXW7) ELISA kit

E08F0338-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog F box/WD repeat containing protein 7(FBXW7) ELISA kit

E08F0338-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog F box/WD repeat containing protein 7(FBXW7) ELISA kit

E08F0338-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse F- box/WD repeat- containing protein 7, Fbxw7 ELISA KIT

ELI-20808m 96 Tests
EUR 865.00

Human F- box/WD repeat- containing protein 7, FBXW7 ELISA KIT

ELI-27065h 96 Tests
EUR 824.00

Pig F box/WD repeat containing protein 7(FBXW7) ELISA kit

E07F0338-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig F box/WD repeat containing protein 7(FBXW7) ELISA kit

E07F0338-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig F box/WD repeat containing protein 7(FBXW7) ELISA kit

E07F0338-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

F-Box And WD Repeat Domain Containing 7 (FBXW7) Antibody (HRP)

20-abx317509
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 7 (FBXW7) Antibody (FITC)

20-abx317510
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

F-Box And WD Repeat Domain Containing 7 (FBXW7) Antibody (Biotin)

20-abx317511
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

FBXW7 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0767606 1.0 ug DNA
EUR 167.00

FBXW7 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0767607 1.0 ug DNA
EUR 167.00

FBXW7 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0767608 1.0 ug DNA
EUR 167.00

Fbxw7 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4531706 1.0 ug DNA
EUR 167.00

Fbxw7 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4531707 1.0 ug DNA
EUR 167.00

Fbxw7 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4531708 1.0 ug DNA
EUR 167.00

Recombinant F-Box And WD Repeat Domain Containing Protein 7 (FBXW7)

4-RPJ890Hu01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: Q969H0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.0kDa
  • Isoelectric Point: 9.3
Description: Recombinant Human F-Box And WD Repeat Domain Containing Protein 7 expressed in: E.coli

Recombinant F-Box And WD Repeat Domain Containing Protein 7 (FBXW7)

4-RPJ890Mu01
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: Q8VBV4
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.6kDa
  • Isoelectric Point: 7.3
Description: Recombinant Mouse F-Box And WD Repeat Domain Containing Protein 7 expressed in: E.coli

Guinea pig F box/WD repeat containing protein 7(FBXW7) ELISA kit

E05F0338-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig F box/WD repeat containing protein 7(FBXW7) ELISA kit

E05F0338-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig F box/WD repeat containing protein 7(FBXW7) ELISA kit

E05F0338-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig F box/WD repeat containing protein 7(FBXW7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Protein

20-abx166205
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Mouse F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Protein

20-abx166209
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Human F-Box and WD Repeat Domain Containing 7 (FBXW7) ELISA Kit

abx387334-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

F-box and WD-40 domain protein 7 isoform 1 (FBXW7) polyclonal antibody

ABP-PAB-10563 100 ug Ask for price
    • Product line: Transcription Factors
    • Brand:

F-box and WD-40 domain protein 7 isoform 2 (FBXW7) polyclonal antibody

ABP-PAB-10564 100 ug Ask for price
    • Product line: Transcription Factors
    • Brand:

F-box and WD-40 domain protein 7 isoform 2 (FBXW7) polyclonal antibody

ABP-PAB-10565 100 ug Ask for price
    • Product line: Transcription Factors
    • Brand:

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Polyclonal Antibody (Human)

4-PAJ890Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: FBXW7 (Asp279~Val515)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human F-Box And WD Repeat Domain Containing Protein 7 (FBXW7)

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Polyclonal Antibody (Mouse)

4-PAJ890Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: FBXW7 (Cys312~His545)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse F-Box And WD Repeat Domain Containing Protein 7 (FBXW7)

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Polyclonal Antibody (Human), APC

4-PAJ890Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: FBXW7 (Asp279~Val515)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human F-Box And WD Repeat Domain Containing Protein 7 (FBXW7). This antibody is labeled with APC.

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Polyclonal Antibody (Human), Biotinylated

4-PAJ890Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: FBXW7 (Asp279~Val515)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human F-Box And WD Repeat Domain Containing Protein 7 (FBXW7). This antibody is labeled with Biotin.

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Polyclonal Antibody (Human), Cy3

4-PAJ890Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: FBXW7 (Asp279~Val515)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human F-Box And WD Repeat Domain Containing Protein 7 (FBXW7). This antibody is labeled with Cy3.

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Polyclonal Antibody (Human), FITC

4-PAJ890Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: FBXW7 (Asp279~Val515)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human F-Box And WD Repeat Domain Containing Protein 7 (FBXW7). This antibody is labeled with FITC.

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Polyclonal Antibody (Human), HRP

4-PAJ890Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: FBXW7 (Asp279~Val515)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human F-Box And WD Repeat Domain Containing Protein 7 (FBXW7). This antibody is labeled with HRP.

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Polyclonal Antibody (Human), PE

4-PAJ890Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: FBXW7 (Asp279~Val515)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human F-Box And WD Repeat Domain Containing Protein 7 (FBXW7). This antibody is labeled with PE.

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Polyclonal Antibody (Mouse), APC

4-PAJ890Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: FBXW7 (Cys312~His545)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse F-Box And WD Repeat Domain Containing Protein 7 (FBXW7). This antibody is labeled with APC.

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Polyclonal Antibody (Mouse), Biotinylated

4-PAJ890Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: FBXW7 (Cys312~His545)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse F-Box And WD Repeat Domain Containing Protein 7 (FBXW7). This antibody is labeled with Biotin.

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Polyclonal Antibody (Mouse), Cy3

4-PAJ890Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: FBXW7 (Cys312~His545)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse F-Box And WD Repeat Domain Containing Protein 7 (FBXW7). This antibody is labeled with Cy3.

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Polyclonal Antibody (Mouse), FITC

4-PAJ890Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: FBXW7 (Cys312~His545)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse F-Box And WD Repeat Domain Containing Protein 7 (FBXW7). This antibody is labeled with FITC.

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Polyclonal Antibody (Mouse), HRP

4-PAJ890Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: FBXW7 (Cys312~His545)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse F-Box And WD Repeat Domain Containing Protein 7 (FBXW7). This antibody is labeled with HRP.

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Polyclonal Antibody (Mouse), PE

4-PAJ890Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: FBXW7 (Cys312~His545)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse F-Box And WD Repeat Domain Containing Protein 7 (FBXW7). This antibody is labeled with PE.

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Polyclonal Antibody (Human), APC-Cy7

4-PAJ890Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: FBXW7 (Asp279~Val515)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human F-Box And WD Repeat Domain Containing Protein 7 (FBXW7). This antibody is labeled with APC-Cy7.

F-Box And WD Repeat Domain Containing Protein 7 (FBXW7) Polyclonal Antibody (Mouse), APC-Cy7

4-PAJ890Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: FBXW7 (Cys312~His545)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse F-Box And WD Repeat Domain Containing Protein 7 (FBXW7). This antibody is labeled with APC-Cy7.
METHODS
Data coming from 4 pollen monitoring stations in the Berlin and Brandenburg space in Germany and for three years (2014-2016) have been used to analyze the correlation of season definitions, birch and grass pollen counts and complete nasal symptom and mediation scores as reported by sufferers in “Patients Hay fever Diaries” (PHDs). After the identification of pollen durations on the foundation of the EACCI standards, a statistical evaluation was employed, adopted by an in depth graphical investigation.
RESULTS
The evaluation revealed that the definitions of pollen season in addition to peak pollen interval begin and finish as proposed by the EAACI are correlated to symptom hundreds for grass and birch pollen-induced allergic rhinitis reported by sufferers in PHDs.
CONCLUSIONS
Based on our evaluation, the validity of the EAACI definitions on pollen season is confirmed. Their use is advisable in future medical trials on AIT in addition to in each day routine for optimum affected person care.

Leave a Comment